Грунтовка от грибка: Грунтовка от плесени и грибка глубокого проникновения

Содержание

Грунтовка от плесени и грибка глубокого проникновения

Появления плесени беспокоит многих. Пятна могут испортить дорогую отделку стен, кафель, обои. Но испорченные стены — это еще не самое страшное.

Эта проблема наносит вред здоровью, и если ее вовремя не устранить, то она может вызвать проблемы для жизни. Грунтовка может навсегда устранить эту проблему.

Перед использованием этих средство стоит выяснить что такое плесень и почему она возникает в помещениях.

Почему возникает плесень

Споры грибков могут появиться в любом месте, но их развитие начнется, когда создадутся наиболее благоприятные условия.

Они развиваются во влажной среде с плохим проветриванием. Очень часто эти проблемы возникают в ванной комнате.

Если в помещении вдруг возникла плесень, для начала стоит решить проблему повышенной влажности и плохого проветривания. Иначе она будет появляться снова и снова, даже если будут использоваться супер эффективные средства для устранения этой напасти.

Меры по удалению

Во время удаления плесени стоит выполнять комплексную борьбу. В этом поможет грунтовка.

Все мероприятия должны выполняться так:

  • Удаляем механическим способом пятна с мест распространения;
  • Обрабатываем поверхность грунтовкой против грибка;
  • Материалы, которые сильно поражены, необходимо выбросить;
  • Проводим хорошее проветривание помещения;
  • Уровень влажности должен быть в норме.

Грунтовка

Это средство способно полностью избавить от образования пятен на стенах. Оно может не только их удалить, но и предотвратит дальнейшее образование.

Грунтовку можно купить в любом магазине строительных материалов.

Пользоваться ей достаточно просто. Во время использования ее не нужно разбавлять с водой, раствор следует наносить в чистом виде.

Во время применения средства, желательно полностью ознакомиться с инструкцией. Это поможет наиболее эффективно устранить пятна.

Виды

Грунтовка от грибка бывает нескольких видов, которые отличаются по составу. В основном используют алкидные, минеральные и акриловые.

В основу этих грунтовок добавляют фунгициды, которые предотвращают развитие вредоносных микроорганизмов.

Эти средства борются против грибка и выполняют функции антисептического и антибактериального средства.

Перед применением нужно прочитать инструкцию – далеко не все антисептики могут избавить от плесени, некоторые рассчитаны только на борьбу с вредителями.

Для какого материала подходит та или иная грунтовка. Порою наибольший эффект достигается только в том случае, если выбранный раствор подходит под тип поверхности.

Грунтовки подходят для следующих материалов:

  • Бетонных поверхностей;
  • Стен, полов из деревянного материала;
  • Кирпичных конструкций;
  • Поверхностей из гипсокартона;
  • Всевозможных конструкций из пенополистирола;
  • Поверхностей из шпаклевки и гипсовой штукатурки;
  • Стен и полов с покрытиями из цементной штукатурки.

Производители

Наиболее большим спросом на современном рынке строительных материалов пользуются следующие грунтовки.

«Mill kill». Раствор глубоко проникает в поверхность, почти до 3 см. Его можно использовать для укрепления рыхлой и плохо держащийся поверхности.

Производитель рекомендует наносить его в несколько слоев, лучше всего в 2-3 слоя. Подходит для помещений с высокой влажностью.

«Elegant 296» — это изолирующая грунтовка. Она препятствует проникновению влаги к подложке. Подходит для всех типов поверхностей. Также хорошо закрашивает черный цвет до белого. В состав этого раствора входит пленкообразующее вещество, которое замедляет впитывание воды из грунта.

«Ареал-Пример» — это акриловая грунтовка. В ее состав входят различные виды фунгицидов, которые уничтожают бактерии и препятствуют их повторному образованию. Она выполняет функции антисептического средства, не имеет запаха и укрепляет наружный слой поверхности.

«Acryl Grundierung» — это антигрибковое средство, которое имеет акриловую основу. При нанесении раствора, происходит снижение качеств поверхности впитывания влаги.

«Ceresit CT-99» — это концентрированный раствор, который эффективно устраняет плесень, грибок, разросшийся мох и лишайники. Он является экологически безопасным. Это средство проникает вглубь поверхностей, и на долго устраняет проблему. Его можно использовать как внутри помещения, так и снаружи.

Запомните, антигрибковые грунтовки являются только лишь профилактическими средствами. Их нужно наносить для предотвращения образования плесени, но не чтобы от нее избавиться.

Для устранения этих проблем нужно использовать антигрибковый концентрат.

Рекомендации по использованию

Чтобы средство помогло справиться с проблемой, его не нужно наносить именно на пятна.

Поверхность нужно заранее промыть от растительности раствором хлорки или бензина. Для очищения лучше использовать щетку с жестким ворсом.

Только после полного высыхания и выветривания хлора можно приступать к смыванию. После выветривания и высыхания, стены можно прогреть паяльником или строительным феном. За счет этого, действие грунтовки может существенно продлиться.

Чтобы в помещении не возникла эта проблема, перед отделкой обработайте стены антигрибковыми средствами.

Плесень может навредить здоровью. Лучше заранее предупредить появление этой проблемы.

Применение грунтовки против грибка и плесени

Защита поверхностей жилых помещений от плесени – обязательное условие их отделки и эксплуатации, отказ от этого этапа в прямом смысле опасен для здоровья и состояния строительных конструкций. Грунтовка против грибка и плесени используется при возведении и декорировании деревянных конструкций, подготовке оснований любого типа перед финишной отделкой, необходимости очистки поверхностей от развитых колоний патогенных микроорганизмов и ряде других задач. При правильном подходе ее состав, назначение, способ нанесения и другие рабочие характеристики учитываются вместе с типом обрабатываемых поверхностей и условиями их эксплуатации.

Причины появления плесени, грибка

Среди основных причин образования плесени внутри помещений выделяют избыточную влажность, низкое качество или отсутствие гидроизоляционных, утепляющих прослоек, ошибки при обработке стыков панельных конструкций, аварийное состояние крыш или стен, наличие продуваемого, промерзаемого чердака, и, что самое характерное – плохие показатели воздухообмена. При уровне влажности выше 85% ситуация становится критической, грибковые точечные колонии начинают быстро размножаться, прорастают в плесневую форму с активно выделяемыми спорами и становятся видны невооруженным глазом. Помимо внешнего проявления к признакам появления грибка или плесени относят спертый неприятный запах.

Основную опасность представляют грибковые споры, переносимые по воздуху, с легкостью проникающие в дыхательные пути. Последствия проявляются в общем ослаблении организма, отравлении токсинами, развитии аллергических реакций, астмы, воспалений и ринитов. В сложных случаях споры поражают внутренние органы, дыхательную, пищеварительную, сердечно-сосудистую систему и приводят к развитию серьезных заболеваний.

Как выглядит плесень в квартире

Помимо непосредственной опасности для человека появление плесени отрицательно сказывается на целостности, прочности и привлекательности строительных конструкций. Прорастающие грибковые колонии разрыхляют штукатурки, ослабляют цементные стяжки, разрушают обои и декоративные покрытия. Чаще опасность они представляют для дерева, при отсутствии антисептической защиты конструкции из этого материала могут сгнить за 1-2 года.

В зависимости от вида плесневелого гриба выделяют:

  • Белую плесень, чаще прорастающую в цветочных горшках, реже – на древесных, бумажных поверхностях. Легко удаляется после устранения причины, серьезной опасности не представляет.

    Белая плесень

  • Зеленую плесень, неисправимо порчащую продукты питания, в редких случаях прорастающую на кирпичных кладках. Прямую опасность представляет только при попадании внутрь с пищей.

    Зеленая плесень

  • Синюю плесень, прорастающую на поверхности и внутри деревянных конструкций, представляющую серьезную угрозу для их целостности. Легкая синева необработанных поверхностей быстро сменяется серьезным изменением цвета на серый, синий или сине-черный, при отсутствии мер дерево сгнивает за несколько месяцев.

    Синяя плесень

  • Грибки гниения дерева, внешне практически не проявляющиеся вплоть до образования на балках или досках трещин, потери прочности, веса и прорастании серых или бурых колоний.

    Грибок гниения дерева

  • Черную плесень, признанную самой опасной как для состояния конструкций, так и для здоровья. К первым признакам ее появления относят прорастание черных точек на участках с самой плохой вентиляцией (углы, откосы, труднодоступные места, плинтусы за мебелью), увеличивающихся до заметных темных пятен.

    Черная плесень

Следует помнить, что после однократного появления и при отсутствии антисептической защиты грибные споры проникают внутрь конструкций и могут прорасти в любой момент, даже при условии удаления колоний с внешних покрытий. Предотвратить или остановить этот процесс поможет только обработка грунтом с добавками фунгицидов и аналогичных антисептических веществ.

Виды грунтовок: как выбрать состав правильно

Грунтовка подбирается из поставленных задач и совместимости с материалом основания. Большая часть предлагаемых марок считаются универсальными, но есть специализированные грунты для антисептической обработки минеральных поверхностей или дерева. Четкого разделения не существует, но как правило:

  • При обработке оштукатуренных, нуждающихся в укреплении, кирпичных или пористых минеральных оснований лучше грунтовка глубокого проникновения (Bergauf Tiefgrunt, Cerecit СТ17, Лакра интерьерный грунт, Acryl Grundierung, Mill kill и многие другие). При выборе таких антисептиков существенно сокращаются траты на финишное шпатлевание или клеи и обеспечивается максимально высокий уровень защиты от плесени.
  • При защите деревянных поверхностей грунтовка подбирается с учетом совместимости с внешними лакокрасочными покрытиями (при наличии), условиями эксплуатации. Предпочтение отдается невымываемым многофункциональным составам с добавками антипиренов и инсектицидов. Лучшие отзывы в этой группе имеют серия Neomid, марки Altax Boramon C30, Dufa-Holzlasur, Pinotex Base.
  • Для бетона с низким водопоглощением лучше всего подходят универсальные составы и грунты с высокой адгезией. Последние при этом могут быть поверхностными, а значит – только профилактическими.

Особое внимание обращается на основу противогрибковой грунтовки, оказывающей прямое влияние на температурный диапазон применения, глубину проникновения, показатели адгезии и другие, не менее важные рабочие характеристики. От этого критерия выделяют:

  • Акриловые грунтовки, признанные универсальными, имеющие оптимальные показатели в плане цены, экологичности, адгезии и скорости высыхания. Наличие в составе акриловых смол улучшает показатели сцепления с поверхностью в разы, эти марки с равным успехом используются при наружных, внутренних работах.

    Акриловая грунтовка

  • Грунтовки на гипсовой или цементной основе с добавками извести или жидкого стекла. Минеральные грунтовки имеют низкую цену, активно используются при подготовке бетонных, кирпичных и гипсокартонных поверхностей под оштукатуривание или шпатлевание.

    Грунтовка на гипсовой основе

  • Алкидные грунтовки, оптимально подходящие для защиты древесины от синей плесени, разбухания и гниения. Такие разновидности сохнут дольше акриловых (10-12 ч в сравнении с 3-4 ч), в целом не предназначены для антисептической обработки штукатурки или гипса. Но при необходимости пропитки дерева или профилактической обработки низкоадгезивных поверхностей (стекла или кафеля) им нет равных.

    Алкидная грунтовка

  • Кварцевые грунтовочные составы с добавками песка, характеризующиеся хорошим качеством сцепления, но чаще всего являющиеся профилактическими. Такие марки выбираются при антисептической обработке окрашенного бетона или при подготовке минеральных поверхностей перед нанесением декоративных штукатурок. При необходимости и при условии совпадении основы они могут комбинироваться с другими грунтовками.

    Кварц-грунт

При выборе конкретной марки дополнительно обращается внимание на:

  • Назначение грунта и глубину его проникновения. Большинство поверхностных марок являются профилактическими, не пригодны для удаления грибка внутри конструкций.
  • Показатели расхода и допустимость растворения водой. Практически все грунтовки являются концентратами, но пропорции их затворения, число наносимых слоев стоит уточнить заранее.
  • Время высыхания грунта и условия обработки поверхностей. Практические все марки для стен, потока или пола наносятся на сухие поверхности с помощью валика или распылителя, но ряд специализированных составов вводится непосредственно в строительные растворы.
  • Наличие дополнительных функций (укрепления, защиты от насекомых или атмосферных воздействий).

Способы нанесения и инструменты

Порядок действия зависит от степени поражения поверхностей плесенью и типа защиты. При проведении первичной обработки черновые поверхности очищаются от мусора, просушиваются, при необходимости освобождаются от рыхлых слоев и старых стройматериалов. После этого основание полностью покрывается одним или двумя слоями грунта, хорошо просушивается перед следующим этапом ремонтных или отделочных работ.

При необходимости удаления колоний плесени с поверхности схема меняется: поврежденные участки покрываются специализированными составами или обрабатываются щетками, смоченными в антисептическом составе. Точный порядок действий и потребность в смыве указывается в инструкции, отклонение от которой не допускаются. После удаления плесени с покрытий основания как правило обрабатываются вторым слоем антисептического грунта.

Пропитка поверхностей осуществляется с помощью стандартного набора инструментов:

Общих правил при работе с этими составами немного: грунтовки-антисептики разводятся с учетом рекомендуемых пропорций или просто наносятся на основания при плюсовой температуре среды. К обязательным условиям относят качественную пропитку всей поверхности (труднодоступные участки обрабатываются кистями первыми), наличие сухих участков не допускается. Оптимальные результаты достигаются при многократной обработке поверхностей с тщательной просушкой каждого слоя с соблюдением заявленных производителем условий.

Народные методы

Помимо грунтовок заводского качества для удаления, профилактики плесени, грибка могут использоваться:

  • Растворы любого хлорсодержащего отбеливателя, смешанного с водой в соотношении 1:10, наносимые на стены или пол без потребности в смывании. К преимуществам этого средства относят высокую эффективность (хлорка убивает практически все виды патогенных микроорганизмов, препятствует их обратному появлению), к минусам – едкость, риски повреждения поверхностей.

    Раствор хлорки

  • 3% раствор перекиси водорода, обладающий схожими с хлоркой свойствами (высокая эффективность + отбеливание), но нуждающийся в смывке. Это средство распыляется, оставляется на поверхностях на 5-10 минут, не более и смывается водой вместе с остатками плесени.

    Перекись водорода

  • Уксус, распыляемый на пораженные поверхности на 1 час, смываемый чуть теплой водой.

    Уксус

  • Нашатырный спирт, смешиваемый с водой в равных дозах, наносимый с помощью распылителя или ватного тампона. Из-за быстрого испарения максимальный эффект от его применения достигается при обработке твердых поверхностей, включая кафель в ванной, минимальный – при работе с пористыми основаниями.
  • Высокоэффективный ингибитор развития плесени – буру, затворяемую водой (1 ст. на 2,5 л), наносимую на поверхности жесткими щетками без смывки. При высокой степени поражения стены или пол обрабатываются полученной смесью многократно.

    Бура

  • Водные растворы аммиака в пропорции 1:1, распыляемые и удаляемые чистой водой вместе с остатками плесени. Данное вещество относят к токсичным, по возможности не смешивают с другими компонентами.

    Растворы аммиака

  • Пищевая сода, смешиваемая с водой в небольшой пропорции (1 ч.ложка на 1 л воды), разбрызгиваемая по поверхности и удаляемая через 1 час. Этот же состав считается оптимальным при необходимости удаления спертого запаха грибка.

    Пищевая сода

  • Эфирные масла (чайное дерево, лаванда, розмарин, экстракты цитрусовых косточек), смешиваемые с водой в небольшом количестве (10 капель или 1 ч.ложна на 1 ст. воды), распыляемые без смывки. В основном такие средства рекомендуют использовать в качестве профилактических, чем дольше они будут оставаться на стенах, тем лучше будет защита.

    Эфирные масла

  • Слабые (1 ч.ложка на 1 л воды) растворы марганцовки, по аналогии наносимые без потребности в смывании.

    Слабый раствор марганцовки

  • Лимонная кислота или капли лимонного сока (1 ч.ложка на 1 ст. воды). Такие концентраты подходят для промывки швов и поверхностей, облицованных плиткой.

    Лимонная кислота

  • Другие, самостоятельно приготовленные смеси. Примером служит соотношение воды, перекиси, уксуса, борной кислоты 4:2:2:1, водный раствор медного купороса (0,5кг на 10 л) с 2 ложками уксусной кислоты, смываемые смеси отбеливателя, жидкого мыла, пищевой соды и эфирных масел.

Стоит отметить, что практически все высокоэффективные народные средства, включая хлор, аммиак, перекись водорода, концентраты органических кислот и буру, являются опасными для здоровья. Из-за рисков образования токсичных паров их нельзя смешивать между собой (что особенно актуально по отношению к хлору и аммиаку). Работы по подготовке, использованию растворов в любом случае ведутся в перчатках, пробная порция делается небольшой и наносится на незаметные участки.

Заключение

Комната без плесени и грибка

В заключение стоит отметить, что самая эффективная грунтовка против грибка и плесени будет бесполезна при эксплуатации поверхностей в условиях избыточной влажности и плохой вентиляции. Появление грибковых колонии при достаточной и в целом надежной антисептической защите свидетельствует о серьезных проблемах с изоляцией или воздухообменом, нуждающихся в немедленном исправлении.

Понравилась статья? Поделиться с друзьями:

Как вывести плесень на стенах и защитить свой дом от грибка

Грибок на стенах часто возникает по причине повышенной влажности и плохой вентиляции дома.

Нет вентиляции, повышенная влажность, не правильная установка пластиковых окон, сдвинут изолирующий шов между панелями – частые причины плесени на стенах.

Откуда плесень?

Плесень - вид грибковых образований, которые способны размножаться спорами. Благоприятной средой для этого грибка есть повышенная влажность и тепло в закрытых, не дышащих комнатах. Именно поэтому чаще грибок живет в ванных и на чердаках. Кроме этого причиной возникновения плесени может стать протечка сантехники и плохая изоляция труб, в следствие чего накапливается избыточная влага.

Зачастую грибковые колонии  имеют черный цвет. Если сразу не удалять пятна плесени и не устранять причину, грибок может разойтись по всей площади стен и потолка. Хлорсодержащий раствор поможет выявить плесень: если им обработать потемневшее место и оно отбелится через время, то это грибок, а если нет, то это обычная грязь.

Для уничтожения грибковой болезни на стенах необходимо изучить причины ее образования. Злокачественные споры, способствующие размножению, могут присутствовать в воздухе и в воде постоянно, но стоит им попасть в благотворную среду, они мгновенно начинают размножаться и расти.

Плесень может жить практически на любых стройматериалах, в бытовой технике, книгах, одежде и т.д. Современный рынок уже активно предлагает сильные средства для борьбы с этой болезнью дома. О них поговорим ниже в статье.

Признаки плесени в доме:

  • сырой и резкий запах
  • серые, а дальше черные, пятна на стенах и потолке
  • ухудшение здоровья
  • упадок сил
  • плохое настроение и низкая концентрация внимания
  • головные боли

Выводит грибок со стен нужно в комплексе, начиная с устранения причины его роста. Кроме отчистки и отмывания грибковых очагов, в доме должен быть оптимальный  микроклимат, который не даст плесени шансов на возобновление.

Порядок работ по уничтожению грибка на стенах:

  • используя механические инструменты, очистить все поврежденные стены;
  • обработать все поверхности антигрибковыми средствами;
  • сжечь все, что испорчено спорами плесени;
  • создать циркуляцию чистого воздуха в этих комнатах;
  • сократить влажность до минимума, найти и устранить ее источники.

Как вывести грибок самостоятельно: современные средства

Если грибок уже есть, то вывести его можно с применением специальных антисептических продуктов, которые можно купить в магазинах «Домового». Выбирая биозащиту для удаления плесени, помните, что она часто химическая и опасная. Поэтому внимательно читайте инструкцию на таре и проводите работы в специальной одежде.

Обои и мягкую мебель придется менять, если они повреждены грибком. Плесень в порах таких вещей не может быть уничтожена.

Народные средства для уничтожения плесени

  • Отбеливатель
  • Уксус
  • Перекись водорода
  • Использование нашатырного спирта на кафеле
  • Растворы пищевой соды

Антисептическая грунтовка и антигрибковые средства

Такая грунтовка есть в линейках продуктов почти каждой торговой марки.

Это средство имеет две основные функции:

  • уничтожает плесневую болезнь;
  • защищает от последующего образования.

Антисептик этого типа легко применять, так как его состав не требует подготовки и разбавления водой.

Краткий обзор эффективных средств по борьбе с плесенью:

Биозащита Triora

Предназначена для уничтожения и профилактики грибка, мха, водорослей, плесени с оштукатуреных, каменных и бетонных поверхностей внутри и снаружи дома.

Грунтовка глубокого проникновения антисептическая "SuperBase" от Фарбекс

Содержит ионы серебра для профилактики плесени и выраженного антибактериального эффекта. Применима для любых поверхностей.

Антиплесень(концентрат) Shimmelstopp Dufa

Добавка для придания фунгицидных свойств водно-дисперсионным краскам и штукатуркам. Помогает избежать появления на поверхностях плесени и других микроорганизмов.

Противогрибковая грунтовка Байрис "Биостоп"

Грунтовка является готовым к применению биоцидным и биозащитным раствором на водной основе. Продукт создан для защиты и профилактики роста бактерий, черного грибка, плесени, водорослей и дрожжевого грибка на шифере, штукатурке, малярных покрытиях, на окрашенных стенах, каменной кладке, черепице.

BORAMON противогрибковый Altax

Подходит для деревянных покрытий. Уничтожает плесень и грибки, защищает стены от повторного появления бактерий и микроорганизмов.

СТ 99 Антимикробная грунтовка от Ceresit

Органический биоцид для удаления плесени, грибков, бактерий, водорослей, мхов на минеральных поверхностях.

Грунтовка Caparol Capatox антигрибковая

В состав средства входят альгицидные и фунгицидные добавки. Химически активные вещества убирают грибки и плесень, грунтовка эффективно очищает стены и готовит их к дальнейшей обработке.

Все эти продукты можно купить в магазинах строительной сети или заказать консультанту интернет-магазина «Домовой» посредством телефонной заявки.

Чтобы нанести грунтовку, сначала удалите пятна грибка. Возможно, чистить стены придется до кирпича или бетонной плиты.

Чтобы избежать вторичных появлений плесени, нужно создать регулярную циркуляцию воздуха и сухость стен в доме.

Не забывайте утеплять свой дом правильно – извне. Все строительные работы должны быть произведены специалистами, чтобы избежать проблем с повышенной влажностью, холодными стенами, появлением опасной плесени.

виды, список составов от плесени и грибка

Антигрибковая грунтовка имеет состав, который помогает в борьбе с плесенью. Поскольку грибковые споры быстро размножаются и распространяются, надо использовать противогрибковый грунт. Он предотвратит развитие очагов поражения и уничтожит их на корню.

Причины плесени и грибка

У человека, который постоянно находится в помещении c поражёнными плесенью стенами, часто снижается иммунитет, появляется общее ослабление. Грибные споры очень летучи, поэтому они переносятся по воздуху и попадают в дыхательные пути человека, провоцируя аллергическую реакцию и бронхолегочные патологии. Плесень может выделять токсины, оказывающие пагубное влияние. У людей, живущих в заплесневелых помещениях, часто развивается астма, кашель, диатез, головная боль, микотоксикоз, воспаление среднего уха и ринит. В тяжёлых формах поражения спорами плесневого гриба могут диагностироваться проблемы в работе сердечно-сосудистой системы, поражения других внутренних органов.

Плесень влияет на внешний вид материалов. Грибок разрыхляет штукатурку, расслаивает её, а деревянные поверхности превращает в труху.

От появления плесневых грибков не застраховано ни одно помещение. Сложность доставляет выявление проблемы на первых этапах её развития, поскольку споры сначала размножаются внутри материала.

Причины плесени:

  • плохая гидроизоляция основания здания;
  • плохое утепление стен и основания здания;
  • плохо проведённая обработка стыков между панельными плитами;
  • крыша в аварийном состоянии;
  • промерзаемость чердака;
  • оконные блоки низкого качества;
  • плохая вентилируемость помещения;
  • нерегулярное проветривание помещения;
  • плохие характеристики влагостойкости пола. Чаще касается деревянных покрытий.

Перечисленные условия идеальны для развития плесени. Чтобы не допустить поражения грибком стен, их нужно обрабатывать антисептиком на черновом этапе, и во время завершающей отделки, при оштукатуривании или шпатлевании.

Классификация по назначению

Плесенью могут покрыться разные по структуре материалы, поэтому обрабатывать противогрибковыми средствами нужно не только дерево, но и кирпич, бетон, прочие поверхности. Грунт антисептик может наноситься на гипсокартонные и оштукатуренные стены. Для каждого из перечисленных материалов предусмотрен разный вид грунтовки.

В зависимости от назначения грунтовка может быть обычной и глубокопроникающей.

  • Обычная. Для профилактики плесени.
  • Грунтовка глубокого проникновения по бетону. Обрабатывают поверхности, которые уже поражены грибком. Средство уничтожает споры, проросшие вглубь материала.

Виды антисептических грунтовок по составу

  • Акриловая. На основе акриловых смол. Улучшает адгезионные свойства обрабатываемых материалов. В ней нет вредных веществ, быстро сохнет. Её используют в помещениях с повышенной влажностью (ванные комнаты, санузлы, подвалы, погреба, бассейны, кухни). Можно использовать во время наружных работ.
  • Минеральная. Грунтовка для обработки поверхностей из бетона, кирпича, силикатных поверхностей и оштукатуренных стен. Компоненты грунта – гипс или цемент. В основе натуральные ингредиенты, поэтому не представляет опасности.
  • Алкидная. Состав для пропитки дерева. Он не просто предотвращает разрастание грибка, но и не допускает разбухания древесных волокон. Средством можно защищать кафель, стальные или стеклянные поверхности. Действие состава на гипсокартоне или штукатурке слабовыраженно.
  • . Используется перед покраской и нанесением декоративной штукатурки. Одним из основных компонентов грунта является песок, повышающий адгезионные свойства. Полученный после высыхания средства слой имеет шероховатость.

Как выбрать грунтовку

При неверном подборе грунтовки от плесени и грибка обработка стен не принесёт необходимого результата.

Существуют грунты для поверхностей с минимальным поражением грибком, и применяемые в профилактических целях. Если у вас такая ситуация, при выборе грунта берите во внимание следующие нюансы.

  • Область использования. Бывает грунтовка универсального назначения. Может продаваться средство под определённый вид поверхности. В строительстве и ремонте часто используются грунты по бетону, штукатурке, кирпичу, но иногда может понадобиться средство для деревянных и других поверхностей.
  • Устойчивость к атмосферным осадкам. Свойством должны обладать грунтовки, которыми будут обрабатываться наружные стены.
  • Адгезионные свойства. Грунтовка глубокого проникновения с антисептиком намного лучше борется с плесенью. Поверхностные составы можно использовать только с профилактической целью.
  • Водоотталкиваемость. Важна при обработке стен, подверженных постоянному воздействию воды. Водостойкие грунты не только защищают поверхность от плесени, но и от воздействия влаги, конденсата.

Качественный грунт объёмом 10 л не может стоить меньше 1 тыс. р. Составы за 300-500 р. вряд ли будут обладать антисептическими характеристиками, даже если они указаны на этикетке.

При масштабном поражении стен грибком лучше использовать концентрированную грунтовку.

  • Средством обрабатываются очаги плесени, лишайников и мхов. Поскольку в концентрате намного выше доля фунгицидной добавки, она эффективнее борется с плесневыми очагами.
  • За 1 л концентрата можно в среднем заплатить порядка 350 р..
  • Для наиболее глубокого проникновения обрабатывать поверхность нужно не менее 2-3 раз. Трёхслойное нанесение уничтожит проблему не только на поверхности, но и в глубоких слоях материала.
  • Концентрат легко разбавляется водой и может использоваться для профилактики плесени. Соотношение воды и состава указаны на этикетке, будет зависеть от типа обрабатываемой поверхности.

Добавки

Кроме готовых составов и концентратов, в строительстве пользуются добавками. Они не являются самостоятельными грунтующими средствами, но также эффективны против плесени.

Добавки имеют свои особенности.

  • Продаются в упаковках по 0,25 кг. Подмешиваются в 10 л обычной грунтовки. Добавление придаёт простому грунту антисептический эффект.
  • Противогрибковая добавка может разводиться в краске в аналогичном соотношении (0,25 кг к 10 л), в штукатурке, при этом одной бутылки средства достаточно на 25 кг готового штукатурного раствора. Стойкость отделки к плесени при добавлении добавки увеличивается в несколько раз.
  • Одна бутылка средства стоит 350 р. Это низкая цена, если учесть, что одной порции хватает на целое ведро грунта.

Если же грибок развивается на стенах не очагами, а занимает огромные площади, лучше всего выбирать для борьбы не грунтовки, а специальные антисептики, уничтожающие плесень.

Список грунтовок

Производители предлагают различные составы в зависимости от конечной цели использования. Рассмотрим наиболее ярких представителей каждого вида.

Для профилактики грибка и плесени

Профилактические грунтовки не допускают размножения вредоносной флоры.

  • Milkill – грунтовка против плесени для обработки кирпича и бетона. Её состав попадает глубоко в материал. Допускается применение на уже поражённых бактериями участках.
  • Acryl Grundierung – состав глубокого проникновения, имеющий акриловую основу. Обладает противобактериальными, противогрибковыми и адгезионными свойствами. Им можно обрабатывать бетонные, кирпичные основания, которые будут штукатуриться или окрашиваться.
  • Schimmel Stop Dufa – добавка фунгицидного типа. Её дополнительно подмешивают в краску или штукатурку. Наносится во время покраски мест, где уже есть очаги плесени. Добавляется с профилактической целью.
  • Mixonit GR 43 – подмешивается в сыпучие строительные смеси. Глубоко проникает, можно наносить на минеральные основания. Имеет высокую поглотительную способность.

Для борьбы

Грунты этой группы борются с имеющимися очагами плесени.

  • Церезит СТ 99 – противогрибковая грунтовка. Это концентрированный состав, безопасный для человека. Подходит для работы внутри здания, обработки бетонных, кирпичных, оштукатуренных поверхностей.
  • Абедис 06 – составом удаляется органический налёт. Обрабатывают кирпичные поверхности, плитку, штукатурку и бетонные дорожки. Может использоваться в качестве профилактической смеси.
  • Dali – антисептик универсального действия. Это профилактическое средство, а также состав для борьбы с имеющимися очагами плесени. Можно обрабатывать бетон, кирпич, штукатурку.
  • Fongifluid Alpa – удаляет плесень, предотвращает её развитие. После устранение очага препятствует повторному заражению. Можно обрабатывать дерево, кирпич, гипсокартон, керамику, черепицу или цементную штукатурку. Покрытые поверхности продолжают пропускать воздух, что нормализует микроклимат в помещении.

Для дерева

  • Dufa-Holzlasur – лазурь для реставрации старых деревянных оснований и для сохранения новых. Наносится тонким слоем, хорошо защищает дерево от погодных явлений, уничтожает грибные споры, предупреждает их размножение.
  • Altax Boramon C30 – пропитка, которая не вымывается из дерева. Это антисептик и инсектицид, уничтожает развивающиеся микроорганизмы.
  • Pinotex Base – подходит для дерева для наружных работ. Имеет алкидную основу. Применяется для грунтования заборов, фасадов, окон и дверей перед покраской. Имеет небольшой расход.

Народные способы

Если есть только мелкие очаги поражения плесенью, для борьбы с ними можно использовать отбеливатели, перекись водорода, пищевую соду или уксус. Все эти средства есть дома. Они интенсивно борются с плесенью, а стоят в несколько раз дешевле промышленных аналогов.

Необходимые материалы и инструменты

Помимо грунтовки, для избавления от грибка и плесени надо приготовить такие средства.

  • «Белизна». Необходима для подготовки основания. Это может быть любое средство, содержащее хлор. «Белизна» — наиболее эффективное из доступных.
  • Кисть или валик со средним ворсом, макловица.
  • Паяльная лампа. Используется для бетона, кирпича или штукатурки. Если убирать плесень нужно с деревянных оснований или других горючих материалов, желательно использовать строительный фен.
  • Резиновые перчатки. Работают с едкими составами на основе хлора только в средствах индивидуальной защиты. Дополнительно можно использовать респиратор или маску, что предотвращает попадание ядовитых паров в органы дыхания.
  • Жёсткая губка или щётка с жёстким ворсом. Щёткой намного эффективнее и быстрее удаляется грибок со стен.

Как правильно наносить грунт

Лучше грунтовочные работы проводить в тёплое и сухое время года.

Приведём пошаговую инструкцию нанесения противогрибковой грунтовки для стен.

  1. Если поверхность, подлежащая обработке грунтовкой от грибка, оштукатурена, предварительно её нужно осмотреть, найти все отслаивающиеся участки и удалить их. Такие места нужно тщательно зачистить, удаляя все отслоения до того момента, пока не будет достигнут прочный слой. Вероятнее всего, в таких участках могут скрываться очаги плесени.
  2. По инструкции на упаковке «Белизны», её нужно добавить в воду. После создания раствора надо надеть перчатки, респиратор и приступить к оттиранию поврежденных участков белизной. Это можно делать губной или щёткой, намоченной в растворе. Все действия нужно выполнять очень тщательно, чтобы хорошо оттереть грибок. Не нужно жалеть раствор.
  3. Белизна оттирает грибок с поверхности, но обычно заражение имеет глубинный характер. Чтобы устранить проблему в корне, нужно прожечь стену паяльной лампой или строительным феном. Хлорсодержащие средства и воздействие высоких температур пагубно влияет на плесень в толще штукатурки. Без обработки паяльной лампой борьба против плесени будет бесполезной.
  4. После температурной обработки нужно убрать лишнюю влагу из помещения. Особенно это актуально для ванной комнаты. Если грунтование предполагается летом, достаточно на несколько часов сделать интенсивное проветривание помещения. При влажных погодных условиях и низких температурах окружающей среды лучше использовать для просушки помещения тепловую пушку. Её можно арендовать. Поскольку в сухой среде плесень гибнет, необходимо снизить влажность помещения.
  5. Как только стены просохли, надо сразу приступить к грунтованию стен. Чем меньше в них влажности, тем эффективнее действует грунтовка антисептик. Антигрибковый грунт нужно наносить на каждый см. кв., не пропуская ни единого участка, чтобы плесень не могла размножиться. После полного высыхания первого слоя таким же образом наносится грунт повторно. Когда стена полностью высохнет, можно приступать к отделочным работам. Если поверхность пористая или имеет мелкие углубления, наносить грунтовку эффективнее всего кистью-макловицей.

Для усиления антигрибкового эффекта надо добавить дополнительно фунгицид в краску и штукатурку, если она применяется в качестве отделочного материала. Если основание готовится под обои, грунт лучше наносить не в два, а в три слоя.

При правильном выборе грунта и соблюдении перечисленных рекомендаций навсегда можно избавиться от плесени на стенах, предотвратите её появление.

ТЕРРАГРУНТ АНТИПЛЕСЕНЬ Грунтовка против плесени и грибка

Описание

Высокоэффективный состав от Террако, созданный на базе акриловых компонентов. Террагрунт антиплесень глубоко проникает в толщу обрабатываемой поверхности, отличается великолепными связывающими характеристиками. Формула продукта включает высокодисперсные смолы, акрил, особые пигменты, натуральные присадки и специфическую антигрибковую добавку.

ОСНОВНЫЕ СВОЙСТВА АНТИГРИБКОВОЙ ГРУНТОВКИ
  • Защищает поверхность от поражения грибком и плесенью
  • Предотвращает появление микробов различной природы
  • Рекомендовано для обработки плоскостей, выполненных из древесины и гипсокартона, бетона и пенобетона, цемента и поверх ранее нанесенной штукатурки
  • Выступает в качестве связующего покрытия и является высококачественной основой для последующего покрытия плоскости различными строительными материалами
  • Готовый к использованию состав, не требует дополнительного смешивания
  • Отличная адгезия
СФЕРА ПРИМЕНЕНИЯ

Террагрунт антиплесень особо рекомендован для покрытия поверхности, созданной из пенобетона. Кроме того, грунтовый состав отлично подходит для обработки цементосодержащих плоскостей, которые необходимо защитить от поражения грибком. Продукт можно применять в помещениях с высокой степенью влажности и в местах, особо чувствительных к плесени (кухонные помещения, ванные комнаты и т.п.)

ПРЕДВАРИТЕЛЬНАЯ ПОДГОТОВКА ПОВЕРХНОСТИ ПЕРЕД НАНЕСЕНИЕМ

До начала работы тщательно очистите рабочую поверхность. Удалите все виды загрязнений и пыли, избавьтесь от масляных пятен и солевых разводов. Покройте защитной пленкой участки, которые не надо обрабатывать составом. При наличии на поверхности трещин или сколов, отремонтируйте их. С этой целью лучше использовать специальный состав Хэндикоат. Старые или ранее окрашенные плоскости следует дополнительно промыть содовым раствором, ополоснуть и высушить перед нанесением Террагрунт антиплесень.

ПОКРЫТИЕ И ИНСТРУМЕНТ

Грунтовый антигрибковый состав наносится обычной щеткой или с помощью распылителя. После нанесения состав должен высохнуть. Свидетельство готовности – легкий блеск на обработанной поверхности. В случае необходимости грунтовку Террагрунт антиплесень можно нанести в два-три слоя.

ПродуктГрунтовый окрашеный состав с антигрибковым свойством
ОсноваСтироловый акрилат
ЦветПрозрачный
Время высыхания1 слой грунтовки высыхает в течение 2-3 часов
ТоксичностьНетоксичный материал. Не представляет опасности для окружающей среды
Срок хранения24 месяца от даты изготовления. Излишки продукта следует хранить в чистом прохладном помещении в закрытой герметичной таре. Не допускать резких перепадов температуры. Не выставлять под прямые солнечные лучи
УпаковкаПластиковые канистры массой 1 и 5 кг

Биозащита от плесени и грибка в Обнинске

Грунтовка применяется с целью предварительной обработки поверхности стен, пола или потолка. Это нужно для того чтобы улучшить сцепления поверхности отделочных материалов с основанием.

    Грунтовка тифенгрунд кнауф представляет собой полупрозрачную жидкость, которая активно используется для пропитки поверхности, на которую в скором времени будут наноситься отделочные материалы. Таким образом, грунтовка тифенгрунд кнауф улучшить качество работ. Именно от качества кнауф тифенгрунд будет зависеть, на сколько долго поверхность будет сохранять свой вид. Как не раз уже было доказано, knauf tiefengrund никогда не подводил своих покупателей с точки зрения качества и надежности.

    Кнауф тифенгрунд имеет высокую способность проникать даже в самые маленькие поры в поверхности основания. Это позволяет knauf tiefengrund защитить поверхность от воздействия коррозии и от избытка влаги. После использования knauf тифенгрунд любой отделочные материал будет ложиться на поверхность ровнее. А когда укладывается плитка, то использование knauf тифенгрунд помогает обеспечить высокое сцепление с плиточным клеем.

    С какой целью нам нужно использовать грунтовку knauf тифенгрунд? Она способна увеличивать адгезию поверхности в несколько раз, что обеспечивает дополнительное крепление с облицовочным материалом. Грунтовка knauf тифенгрунд будет способствовать меньшему расходу краски. Грунтовка кнауф тифенгрунт дает поверхности дышать. Дополнительным преимуществами грунтовки кнауф тифенгрунт является, то, что она легко наносится и не имеет специфического запаха. Тифенгрунд кнауф, цена которого доступна для каждого покупателя, не выделяет вредные вещества. Стоит также отметить, что установленная в нашем магазине на тифенгрунд кнауф, цена намного ниже, чем у наших конкурентов.

    Грунтовка универсальная КНАУФ Тифенгрунд предназначена для подготовки самых различных поверхностей – бетонных, кирпичных, оштукатуренных (цементно-песчаной, гипсовой и др. штукатуркой), волокнисто цементных оснований, а также любых поверхностей, ранее подлежащих отделочным работам.

    Грунт КНАУФ Тифенгрунд является смесью, полностью готовой к применению. Он обладает высокой проникающей способностью и совмести с поверхностями с высокими гигроскопичными (впитываемость) показателями.

    Грунтовка КНАУФ Тифенгрунд позволяет в кратчайшие сроки (срок высыхания 3 часа) качественно подготовить любую поверхность (используется как для внутренних, так и для внешних работ) к последующей обработке – шпаклеванию, поклейке обоев, окраске, укладке плитки. Она в значительной мере повышает адгезию поверхности, укрепляет «слабые» поверхности (гипсовые, меловые основания) которые имеют склонность к саморазрушению, создавая пленочное покрытие, которое, тем не менее, обеспечивает комфортный воздухообмен (т.е. поверхность обладает способностью «дышать»).

    Расход грунтовки КНАУФ Тифенгрунд при нанесении в один слой составляет 70-100 гр./кв.м.
    Используется для предварительной обработки основания, в целях улучшения адгезии (сцепления покрытия с основанием) и укрепления поверхности при укладке керамической плитки, окраске, приклеивании обоев и шпаклевании.

    Благодаря хорошей проникающей способности пригодна для очень гигроскопичных оснований (гипсовые штукатурки, гипсокартонные листы, наливные полы и др. хорошо впитывающие влагу поверхности).
    Используется как для внутренних, так и наружных работ.
    Процесс применения включает следующие этапы.
   i>Подготовку поверхности.
   >Нанесение.<
    Рекомендации

    Поверхность основания должна быть твердой, сухой, очищенной от загрязнений и отслаивающихся элементов. Не обрабатывать поверхности при температуре воздуха и основания ниже + 5°С.

    Грунтовка проникающая КНАУФ-Тифенгрунд укрепляет поверхность слабых оснований (на меловой, гипсовой основе).
   Повышает адгезию и укрепляет поверхности при укладке керамической плитки, окраске, приклеивании обоев и шпаклевании.</li>
    >Быстро высыхает.<
  >Безопасна для здоровья.<
    Дает возможность «дышать» помещению, так как не изолирует водяные пары внутри сооружения.
    Расход 70-100 г/м2

виды, свойства грунта от плесени

Ключевое средство, предназначенное для борьбы с колониями вредных микроорганизмов – антигрибковая грунтовка для стен, именуемая еще фунгицидной, антисептической или антибактериальной. Плесневые грибы на стенах – самая частая проблема, с которой сталкивается большинство домовладельцев.

 

Плесени свойственно не только губить декоративную отделку, но и разрушать поверхность, а также наносить серьезный вред здоровью окружающих. Особенно часто грибок поражает влажные поверхности. Исключить вероятность образования грибковых спор необходимо еще на этапе чистовых или отделочных работ.

Свойства и виды антигрибкового грунта

Фунгицидные грунтовкижидкость, включающая в свой состав органический растворитель и специальные химические добавки. Их задача – препятствовать образованию плесневых грибов, а при появлении первых спор – уничтожать их.

Основную роль в составе играют фунгициды, которые, вступая в реакцию с новообразованиями, способствуют их разрушению.

Грунтовка против плесени и грибка производится в двух формах:

  1. Обычный антигрибковый состав, используемый для обработки «здоровых» поверхностей. Такой грунт является своеобразным профилактическим средством.
  2. Концентрированная антибактериальная грунтовка. Ее цель – уничтожение уже образовавшегося грибка. Проникая вглубь основания, состав предупреждает возникновение даже моховых наростов и разрушает их.

Назначение

В зависимости от типа обрабатываемого основания грунтовка с антигрибковыми добавками подразделяется на несколько специализированных типов:

  • грунт для дерева;
  • для бетона;
  • для штукатурки;
  • для шпаклевки;
  • для кирпича;
  • для гипсокартона и т.д.

Также антигрибковая грунтовка для стен может быть универсальной. То есть она подходит для обработки всех перечисленных типов оснований, но ее эффект для одной поверхности может проявляться в большей мере, чем для другой. Поэтому лучше отдать предпочтение узкоспециализированному грунту.

Виды

Наряду с предотвращением размножения плесневых спор фунгицидные грунтовки еще должны выполнять главную функцию грунта – упрочнять плоскость, улучшать ее адгезию или глубоко пропитывать основу. С этим прекрасно справляются имеющиеся виды:

  1. Антигрибковая грунтовка глубокого проникновения. Она, проникая в структуру, связывает все отслоившиеся и рыхлые части, тем самым усиливая поверхность. При этом создается тончайший слой, защищающий основание от влаги и сокращающий расход шпаклевки или краски. Глубина проникновения состава может достигать 7 см.
  2. Пенетрирующая грунтовка с антисептиком против плесени. Ее основная задача – укрепление пористых или рыхлых оснований, при проникающей способности не менее 0,5 см.
  3. Адгезионные грунты. Благодаря им обеспечивается хорошее сцепление отделки с основанием;
  4. Специальная антибактериальная грунтовка. Такие составы наделены специфическими свойствами, среди которых морозоустойчивость или стойкость к коррозии.

Антигрибковая грунтовка, цена которой колеблется в пределах от 500 до 870 р. за ведро 10 л, может несколько различаться по составу, что и послужило поводом для следующей классификации:

  • Алкидная грунтовка с антигрибковыми добавками;
  • Акриловая;
  • Минеральная.

Расход антигрибковой грунтовки в среднем равен 150-400 г/м2 на 1 слой. Специалистами рекомендуется обрабатывать поверхности, в особенности неровные или сильно впитывающие, минимум два раза. Средняя плотность – 1000 кг/м3. Время высыхания – 30-120 мин.

Причины появления плесени

Выявить плесень на ранних этапах практически невозможно, поскольку споры начинают появляться в структуре поверхности, разрушая ее изнутри. Первые признаки образовавшего грибка – пятна, отличные от цвета отделки (бурые, серые, черные).

Поэтому антигрибковая грунтовка глубокого проникновения или обычный антигрибковый состав должны использоваться на всех этапах черновой и даже беловой отделки (штукатурка, шпаклевка).

Плесень может образоваться совершенно в любом помещении. Причинами ее появления, чаще всего, является недобросовестность строителей или же брак стройматериалов.

В частности, причинами размножения плесневых грибов являются:

  • Недостаточная гидроизоляция оснований, что приводит к проникновению влаги в толщу, где она постепенно накапливается. Поверхность постоянно влажная, что и нужно для роста грибка.
  • Холодные основания, к тому же подверженные промерзанию. Чаще всего такое можно наблюдать в панельных строениях, когда попался бракованный строительный блок без утеплителя в толще. Также промерзающие стены – проблема нежилых или сезонно заселяемых строений с нарушенной теплоизоляцией.
  • Некачественно заделанные межпанельные стыки.
  • Старые протекающие крыши или достаточно холодные чердачные помещения.
  • Плохая вентилируемость помещения, в том числе нерегулярность проветривания или некачественно установленные оконные блоки.
  • Деревянные поверхности или полы, которым свойственна чрезмерная способность к влагопоглощению.

Профилактические меры

Грунтовка с антисептиком против плесени должна выбираться исходя из типа поверхности (бетон, кирпич, дерево и т.д.), состояния основания (рыхлое, старое, пористое), специфики помещения (устойчивая влажность или неустойчивая).

Поскольку антигрибковая грунтовка для стен – только профилактическая мера, целесообразно осуществить ряд мероприятий, чтобы предотвратить образование плесени:

  • Ликвидировать причину проникновения влаги. Для жителей верхних этажей или собственников частных строений – периодически проверять целостность крыши. Жителям нижних же этажей – дополнительно гидроизолировать пол.
  • Обеспечить помещение должной вентиляцией и следить за ее функционированием.
  • Устранять все протечки связанные с канализационными и водопроводными разветвлениями.
  • Частные строения дополнительно тепло- и гидроизолировать.
  • Периодически проветривать помещения, в частности нежилые, дополнительно протапливая их.

В отношении «проросшего» грибка нужно знать: чтобы искоренить плесень, нужно не только снять всю зараженную отделку, но и обжечь участок газовой горелкой. Это поможет высушить стену и уничтожить грибок.

Затем на очищенную плоскость наносится грунтовка против плесени и грибка. Расход антигрибковой грунтовки напрямую зависит от пористости основания. Однако даже относительно плохо впитывающие основания нуждаются в двух- или трехкратной обработке.

Антигрибковая грунтовка для стен обойдется значительно дешевле, чем демонтаж существующей отделки и замена ее на новую. Соответственно, такая обработка в случае возникновения плесени – неотъемлемый этап ремонтных работ, даже если речь идет о помещениях со стабильной влажностью.

Антигрибковая грунтовка для стен, видео

ПЦР-праймеров для грибков, разработанных для анализа ITS-области экстрактов ДНК окружающей среды | BMC Microbiology

Начальная работа с грибковой ПЦР

Мы начали исследование грибковых праймеров ITS с использованием ITS1-F в качестве прямого праймера, расположенного на 3'-конце SSU, и ITS4-B в качестве обратного праймера в 5'-секции LSU [6 ]. Эти праймеры амплифицируют всю область ITS (рис. 1). Обратный праймер, ITS4-B, не предназначался для амплификации мишеней аскомицетов, однако, исходя из сравнения последовательностей, оказалось, что он может плохо соответствовать многим базидиомицетам.Мы также исследовали обратные праймеры в 5 'секции LSU, разработанные Эггером [16]. Эти праймеры отдельно амплифицируют аскомицетов и базидиомицетов. Все эти праймеры обладают сильными положительными характеристиками, но, поскольку наш морфологический анализ кончиков эктомикоризных корней не дал различий между Ascomycetes и Basidiomycetes, мы разработали праймеры, которые были способны амплифицировать все Dikaryomycota одновременно.

Рисунок 1

Схема расположения праймеров в рибосомной кассете, состоящей из SSU, ITS1, 5.8S, ITS2 и LSU рДНК . Праймеры расположены выше (прямые праймеры) или ниже (обратные) положения их последовательности. ITS1, ITS2, ITS3 и ITS4 от White et al . [5], праймеры ITS8mun, ITS9mun, ITS10mun, NL5mun, NL6Amun, NL6Bmun, NL8mun от Egger [16], праймеры ITS1-F, ITS4-B от Gardes and Bruns [6] и остальные праймеры (NSA3, NSI1, 58A1F, 58A2F, 58A2R, NLB4, NLC2) из ​​этого исследования. Шкала представлена ​​парами оснований в соответствии с расширением системы номенклатуры Гаргаса и ДеПриста [23], описанной в этом исследовании.

Первоначально мы приблизились к нашей цели надежной амплификации ПЦР, широко нацеленной на Dikaryomycota, разработав праймер (NLB3), который хорошо работает с ITS1-F и близок к сайту отжига для ITS4-B. Пара праймеров ITS1-F / NLB3 эффективно исключает последовательности растений, амплифицирует мишени базидиомицетов и, кроме того, амплифицирует мишени аскомицетов. Однако мы обнаружили, что ITS1-F, по-видимому, вызывал ложные полосы продукта из экстрактов ДНК нашей эктомикоризы с низкой концентрацией (кончик одного корня).Источник этих полос был подтвержден повторным усилением только ITS1-F. Пара праймеров ITS1-F / NLB3, как было показано, подходит для микоризных применений в другой лаборатории [17].

Разработка праймера ITS для грибов

Чтобы получить более чистый продукт для рестрикции, мы разработали альтернативу ITS1-F, в результате чего пара праймеров демонстрирует большую специфичность к предполагаемой грибковой рибосомной мишени (рис. 1). Мы также разработали надежную пару праймеров, специфичных для Dikaryomycota (NSA3 / NLC2), которые могут служить в качестве праймеров первого раунда в реакциях вложенной ПЦР с сайтами отжига за пределами тех, что для второй пары праймеров, специфичных для Dikaryomycota (NSI1 / NLB4).Мы широко использовали эту вложенную реакцию для работы ПЦР-ПДРФ с кончиками эктомикоризных корней. Праймер NLB4 идентичен праймеру NLB3, за исключением того, что он имеет одну дополнительную основу на 3'-конце (см. Таблицу 1) и имеет немного более высокую расчетную температуру плавления.

Таблица 1 Характеристики последовательности праймеров, разработанных в этом исследовании.

Дополнительная разработка праймеров, позволяющая раздельно амплифицировать ITS1 и ITS2, дала окончательный набор из 6 праймеров (см. Таблицу 1, Рисунок 1), специфичных для Dikaryomycota: внешние вложенные праймеры для ПЦР (NSA3 / NLC2), пара праймеров, которые амплифицируют оба ITS-области (NSI1 / NLB4), прямой (58A1F, 58A2F) и обратный (58A2R) праймеры в праймерах 5.8S последовательность (перекрывающаяся с ITS3 / ITS2 White et al. [5]) для амплификации внутренних транскрибируемых спейсеров ITS2 и ITS1 соответственно. Внешние вложенные праймеры ПЦР (NSA3 / NLC2) хорошо работают со всеми другими парами грибковых праймеров (рис. 1) в этом наборе и обеспечивают большую чувствительность и специфичность (и могут использоваться для проверки идентичности продукта). Были также разработаны два праймера, специфичные для Plantae (NSIP / NLBP), и в наших исследованиях их можно использовать для проверки того, что грибковый продукт ПЦР не загрязнен последовательностями растений (таблица 1, рисунок 2 и см. Дополнительный файл 1).Эти праймеры расположены в наиболее точных позициях, гомологичных грибковым праймерам, NSI1 и NLB4, по множественному выравниванию последовательностей. Праймеры для растений были успешно применены для LH-PCR и PCR-RFLP-анализа тканей лесных растений из наземных и подземных образцов и хорошо работают при различении репрезентативных образцов растений из леса в Каскадных горах в Орегоне, США, на видовой уровень. Неоднородности по длине было достаточно, чтобы различить более 20 видов подлеска (данные не показаны) в старовозрастном пихтовом лесу (Pseudotsuga menziesii (Mirbel) Franco), но хвойные деревья [пихта дугласова, пихта пихта ( Abies amabilis) (Дугл.) Forbes) и болиголова ( Tsuga heterophylla (Raf.) Sarg.)] Требовали ПЦР-ПДРФ для определения видового уровня.

Рисунок 2

Множественные выравнивания опубликованных последовательностей для сайтов праймеров . Выравнивания последовательностей праймеров изображены с пустыми консенсусными основаниями и отмеченными несоответствующими основаниями. Шесть оснований на 3'-конце праймеров выделены желтым цветом. «Кластеры» были созданы путем сортировки последовательностей в Excel и группирования идентичных последовательностей. Числа «видов на кластер» указывают количество видов с этим шаблоном несоответствия.В выравнивание была включена только одна последовательность на вид (итоговое количество: 584 вида для 18S, 633 вида для 5,8S и 943 вида для 28S). «Номер кластера» - это последовательная нумерация кластеров в порядке убывания «видов на кластер» с последовательностями из базы данных EMBL Fungal, пронумерованными перед последовательностями из базы данных EMBL Plant (последние представлены зеленым шрифтом). Последовательности собирали с использованием FASTA [40] для набора из 12 таксономически репрезентативных грибковых последовательностей для каждой области.Большинство групп несоответствий, содержащих менее 4 видов, были удалены с рисунка для экономии места. Также доступно полное выравнивание [см. Дополнительный файл 1].

Чтобы гарантировать, что набор грибковых праймеров амплифицирует намеченные последовательности-мишени, продукты ПЦР грибов проверяли тремя способами. Во-первых, образцы ПЦР-ПДРФ, полученные в соответствии с текущим протоколом ПЦР, сравнивали с известными образцами, полученными из последовательностей рибосомного оперона Saccharomyces cerevisiae (SCYLR154C, Z73326, S. cerevisiae хромосомы XII) с использованием трех рестрикционных ферментов, чтобы гарантировать сохранение верности. Во-вторых, образцы ПЦР-ПДРФ для реакций ПЦР ITS1 или ITS2 проверяли по тем же образцам, полученным в результате вложенной ПЦР, начиная с пары праймеров первого цикла NSA3 / NLC2. В этом случае недостаточное количество геномной ДНК было перенесено во второй цикл для амплификации самостоятельно, поэтому продукт внутренних праймеров второго цикла должен возникать из целевых последовательностей в первом продукте, а не из другой части генома.В-третьих, для экстрактов ДНК с высоким процентом ДНК растений использовали праймеры для растений NSIP и NLBP для характеристики продукта и / или паттернов, которые могут возникнуть в результате амплификации последовательностей растений из-за недостаточной строгости. Эти методы также были включены в протокол обеспечения качества.

Эффективность новой системы ПЦР грибов

Пара праймеров NSI1 / NLB4 успешно амплифицировала 32 вида грибковых спорокарпов 15 родов, собранных из географически разнообразных мест в Орегоне (все базидиомицеты, кроме Tuber ). Как видно на Фигуре 3, большое разнообразие последовательностей ITS очевидно из вариации длин продуктов ПЦР. Эти амплификации были использованы для проведения кластерного анализа ПЦР-ПДРФ (рис. 4). Пара праймеров NSI1 / NLB4 также успешно амплифицировала 26 видов в 15 родах аскомицетных почвенных микрогрибов, изолированных на чашках для разведения. Никакие виды Zygomycetes glomus не были протестированы, и, судя по данным о последовательностях, маловероятно, что они будут амплифицироваться (рис. 2). Микоризные Ascomycetes, Cenoccocum (идентифицированные визуально и по присутствию интрона ITS1 [18]) и Tuber melanosporum , хорошо амплифицировались и дали образцы рестрикции, согласующиеся с их опубликованными последовательностями (Таблица 2).Интрон ITS1 также обнаружен в Hymenoscyphus ericae [19]. Появление этого интрона ITS1 может быть достаточно широко распространенным, чтобы повлиять на некоторые исследования, где большой размер ампликонов (800–1000 пар оснований) вызывает технические трудности. При необходимости прямой праймер, ITS1 [5], можно использовать с NLB4 в качестве альтернативы, поскольку этот неспецифический праймер находится ниже интрона и может использоваться для предотвращения амплификации интрона.

Рисунок 3

Пример реакции вложенной NSI1 / NLB4 ПЦР, примененной к экстрактам ДНК грибов одного вида .Флуоресцентное изображение бромистого этидия, показывающее электрофорез вложенного продукта ПЦР NSI1 / NLB4 для группы экстрактов спорокарпия. Гель запускали с 0,7% агарозы с высокой точкой плавления плюс 2% добавки Synergel (Diversified Biotech, Boston, MA, каталожный номер SYN-100). Маркер молекулярной массы ДНК Roche VIII (номер по каталогу 1336045) загружали в дозе 100 нг в дорожки 3, 8 и 13 (размеры фрагментов слева от рисунка). В каждую лунку загружали 10 мкл реакции ПЦР для каждой из шаблонов, перечисленных в верхней части геля, а также для контроля без матрицы в последнюю лунку.

Рисунок 4

Дендрограмма и образцы ПЦР-ПДРФ для спорокарпов . В верхнем разделе показаны названия видов и дерево кластеров, полученные в результате анализа наличия / отсутствия данных PCR-RFLP. Размеры фрагментов ПЦР-ПДРФ представлены ниже в парах оснований для ограничений Taq1 , HinF1 и Cfo1 , как указано в правой части рисунка.

Способность этих праймеров амплифицировать грибковые мишени подтолкнула нас к развитию многочисленных совместных проектов, в которых праймеры применялись в широком диапазоне методов.Примеры применения праймеров в текущих проектах включают:

1) амплифицированные эктомикоризные грибы из более чем 2000 экстрактов ДНК с кончиками одного корня [20],

2) пара праймеров NSI1 / NLB4 успешно амплифицировала 30 видов в 18 родах. выделенных на чашках аскомицетных почвенных микрогрибов (идентифицированных докторами Лидией Уотруд и Джеффри Стоуном, личное сообщение),

3) ПЦР-ПДРФ, Т-ПДРФ и анализ прямого секвенирования отдельных морфотипов и целых экстрактов эктомикоризных грибов на Сосна лоблолли, выращенная в Северной Каролине, США [21] (Burke et al , личное сообщение),

4) охарактеризовала эктомикоризные грибы, обнаруженные на корнях эвкалиптов, выращенных в Уругвае [17],

5) анализ эпифитных грибов на сельскохозяйственных посевы методами QPCR и LH-PCR [22].

Из двух праймеров, расположенных в 5.8S, 58A1F дает несколько более устойчивые реакции ПЦР, чем 58A2F, но, судя по сравнению последовательностей, с большей вероятностью испытывает трудности с амплификацией мишеней Cenococcum . Оба хорошо работают с NLB4, обратным праймером LSU, используемым для анализа ITS2. Оба они лежат в последовательности для ITS3 [5] и короче на два основания: 58A1F короче на 5'-конце, а 58A2F короче на 3'-конце.

Метод быстрой экстракции ксантогенатом / твином

В этом исследовании мы также оценили возможное повышение эффективности анализов за счет использования метода быстрой экстракции ксантогенатом / твином (X / T) вместо экстракции CTAB / хлороформ.Сначала мы протестировали метод X / T с добавлением ДНКазы, чтобы подтвердить способность раствора защищать ДНК (коммерчески доступная геномная ДНК S. cerevisiae , номер по каталогу Promega G3101). Сравнение агарозных гелей показало, что деградация или потеря ДНК, связанная с ДНКазой, не обнаруживалась; такой же результат был получен при экстракции CTAB. Выходы ДНК из кончиков одиночных корней с использованием X / T были достаточными для проведения полезных реакций ПЦР для более чем половины проанализированных образцов. Около 80% кончиков отдельных корней, извлеченных методом CTAB, дали ДНК грибов, подлежащую амплификации, с использованием вложенной амплификации, представленной в этом исследовании.В методе X / T примерно вдвое меньше переносов, чем в методе CTAB, и меньше центрифугирования, поэтому мы можем обрабатывать в четыре раза больше образцов за одно и то же время. Грибковая ткань изучаемых нами эктомикориз сосредоточена в основном на внешней стороне кончиков эктомикоризных корней. Не измельчая образцы и, следовательно, извлекая относительно больше с поверхности, чем из внутренней части кончика эктомикоризного корня, мы также уменьшаем количество растительной ДНК и фенольных соединений в экстрактах.Следовательно, для анализов, в которых целью была ПЦР-ПДРФ проверка эктомикоризных корней, сначала классифицированных с использованием общих морфологических признаков, только более здоровые микоризы, вероятно, будут давать сильные образцы для первичных грибковых симбионтов. Это потенциально рассматривалось как положительный атрибут процедуры извлечения X / T. Те кончики корней, которые не смогли дать амплифицируемую ДНК грибов с помощью процедуры X / T, могли образоваться после экстракции CTAB, но также могут быть стареющими корнями, колонизированными сапробными грибами.Другими словами, высокая чувствительность экстракции CTAB в сочетании с вложенной ПЦР несет в себе повышенный риск идентификации сапробных грибов как эктомикоризных грибов, где эктомикоризные грибы отсутствуют, стареют или плохо поддаются амплификации. Возможно, снижение чувствительности процедуры экстракции X / T наряду с потенциальной преимущественной экстракцией ДНК из здоровых микоризных грибов поможет преодолеть этот риск. Однако исследователи должны иметь в виду, что это смещение в сторону грибковой ткани на поверхности корня может привести к недооценке типов грибов, которые в основном обитают в корне.Процедуру экстракции ксантогенатом / твином следует рассматривать как дополнение к экстракциям, включающим гомогенизацию тканей. Комбинация этих подходов может дать некоторые интересные возможности, такие как локализация распространения грибов на корне и в корне.

Сравнение часто используемых наборов праймеров для оценки сообществ арбускулярных микоризных грибов: есть ли универсальное решение?

Особенности

Мы сравнили пять систем праймеров, специфичных для грибов арбускулярной микориз.

Праймеры «Крюгер», как правило, давали наибольшее разнообразие грибов.

Праймерные системы рДНК LSU и SSU были сильно смещены в сторону семейства Glomeraceae.

Данные на основе вложенной ПЦР можно интерпретировать полуколичественно.

Реферат

Различные системы праймеров были разработаны для характеристики сообществ арбускулярных микоризных грибов (AMF); однако отсутствует прямое сравнение их специфичности, потенциала для описания разнообразия и представительства различных филогенетических линий. Используя семь образцов корней, мы сравнили четыре рутинно используемые AMF-специфические системы праймеров для ядерной рибосомной ДНК, покрывающей i) частичную малую субъединицу (SSU), ii) частичную большую субъединицу (LSU), iii) частичную SSU и внутренний транскрибируемый спейсер ( ITS; «Redecker») и iv) частичный SSU – ITS – частичный регион LSU («Krüger»). Кроме того, в сравнение была включена новая комбинация праймеров v), охватывающая область ITS2 (ITS2). Праймеры «Krüger», как правило, давали наибольшее разнообразие AMF и демонстрировали значительно более высокий индекс разнообразия Шеннона, чем праймеры SSU.Мы обнаружили сильную предвзятость в пользу Glomeraceae в системах праймеров LSU и SSU и различия в составе сообществ AMF на основе системы праймеров «Redecker». Наши результаты подтверждают решающую роль выбора целевой области маркера рРНК для анализа сообществ AMF. Мы также предоставляем доказательства того, что данные на основе вложенной ПЦР можно интерпретировать полуколичественно и что степень наблюдаемого чрезмерного доминирования сообщества AMF в значительной степени зависит от выбора праймера.

Ключевые слова

Glomeromycota

Праймеры

рРНК

Арбускулярные микоризные грибы

Разнообразие

454-секвенирование

Рекомендуемые статьи Цитирующие статьи (0)

Все права защищены © 2013 г.,

se Ltd.

Рекомендуемые статьи

Цитирующие статьи

Карты для начинающих - Мэтью П. Нельсен

Обратите внимание, что это НЕ исчерпывающий список праймеров; скорее это праймеры, которые могут быть полезны для тех, кто работает с грибами Ascomycota или водорослями из клады Chlorophyta UTC.

Маленькая субъединица митохондрий грибка:


Грунтовка Ф / Р Позиция Последовательность Каталожный номер
МГУ1 F 116-135 GATGATGGCTCTGATTGAAC Чжоу и Станош (2001)
mtSSU1-KL F 305-323 AGTGGTGTACAGGTGAGTA Lohtander et al. (2002)
MS1 F 532-556 CAGCAGTCAAGAATATTAGTCAATG White et al. (1990)
mrSSU1 F 533-552 AGCAGTGAGGAATATTGGTC Zoller et al. (1999)
мрССУ-1 / 2-5’-мпн F 682-703 GTGCCAGCAGTCGCGGYAANAC Nelsen et al.(2011)
mrSSU2 F 885-904 CTGACGTTGAAGGACGAAGG Zoller et al. (1999)
mrSSU2R R 885-904 CCTTCGTCCTTCAACGTCAG Zoller et al. (1999)
мрССУ-2 / 3-3’-мпн R 1027-1053 GGTGRARTGCTTNCACTTTCATTTATA Nelsen et al.(2011)
MS2 R 1121-1142 GCGGATTATCGAATTAAATAAC White et al. (1990)
mtSSU2-KL R 1504-1524 ATGTGGCACGTCTATAGCCCA Lohtander et al. (2002)
mrSSU3R R 1504-1524 ATGTGGCACGTCTATAGCCC Zoller et al.(1999)
MSU7 R 1594-1615 GTCGAGTTACAGACTACAATCC Чжоу и Станош (2001)
Лотандер, К., И. Оксанен и Дж. Риккинен. 2002. Филогенетическое исследование Nephroma (лишайниковые Ascomycota). Микологические исследования 106: 777-787.

Нельсен, М.П., ​​Люкинг, Р., Мбачоу, Дж.С., Эндрю, К.Дж., Шпильманн, А.А. И H.T. Lumbsch. 2011. Новое понимание взаимоотношений лишайниковых образований. Дотидеомицеты. Разнообразие грибов 51: 155-162.

Белый, Т.Дж., Т. Брунс, С. Ли и Дж. Тейлор. 1990. Амплификация и прямое секвенирование. генов рибосомных РНК грибов для филогенетики. Стр. 315-322 в протоколах ПЦР : Руководство по методам и Приложения (Innis, N., D. Gelfand, J. Sninsky & T. White, Eds.), Academic Нажмите.

Чжоу, S. & G.R. Станош. 2001. Праймеры для амплификации рДНК mt SSU и филогенетическое исследование Botryosphaeria и связанные с ними анаморфные грибы. Микологический Исследование 105: 1033-1044.

Золлер, С., К. Шайдеггер и К. Сперизен. 1999. ПЦР-праймеры для амплификации. митохондриальной малой субъединицы рибосомной ДНК лишайниковых аскомицетов. Лихенолог 31: 511-516.


Грибковая внутренняя транскрибированная спейсер (ITS):

Грунтовка Ф / Р Локус Позиция Последовательность Каталожный номер
* ITS1F F 18S 1731–1752 CTTGGTCATTTAGAGGAAGTAA Сады и Брунс (1993)
ИТС5 F 18S 1745-1766 гг. GGAAGTAAAAGTCGTAACAAGG White et al.(1990)
ИТС1 F 18S 1769-1787 TCCGTAGGTGAACCTGCGG White et al. (1990)
ИТС3 F 5,8S 31-50 GCATCGATGAAGAACGCAGC White et al. (1990)
ИТС2 R 5,8S 31-50 GCTGCGTTCTTCATCGATGC White et al.(1990)
* ИТС2-КЛ R 28S 25-44 TGCTTAAGTTCAGCGGGTA Lohtander et al. al. (1998)
ИТС4 R 28S 41-60 TCCTCCGCTTATTGATATGC White et al. (1990)
LR1 R 28S 57-73 GGTTGGTTTCTTTTCCT Вилгалис И Эстер (1990)
* ITS4A (Ларена) R 28S 71-93 CGCCGTTACTGGGGCAATCCCTG Larena et al. (1999)
* ITS4A (Тейлор) R 28S 96-116 ATTTGAGCTGTTGCCGCTTCA D.L. Тейлор в Kroken & Taylor (2001)
* nu-LSU-136-3 ’ R 28S 136-154 CAAATTACAACTCGGACCC Деринг и др. (2000)

* Праймер преимущественно размножает грибки.

Многие из этих праймеров использовались в комбинации друг с другом для амплификации ITS грибов непосредственно из талломов лишайника.

Позиции SSU относительно Saccharomyces cerevisiae J01353

положения 5.8S относительно Saccharomyces cerevisiae D89886

положения LSU относительно Saccharomyces cerevisiae J01355

Деринг, Х., П. Клерк, М. Грубе & M. Wedin. 2000. Микобионт-специфические праймеры для ПЦР для амплификации ядерная ITS и LSU рДНК лихенизированных аскомицетов. Лихенолог 32: 200-204.

Гардес, М.И Т.Д. Брунс. 1993. Праймеры ITS с повышенной специфичностью для базидиомицетов - приложение к выявление микоризы и ржавчины. Молекулярная экология 2: 113-118.

Kroken, S. & J.W. Тейлор. 2001. Гено-генеалогический подход к распознаванию филогенетических границ видов. у лихенизированного гриба Letharia . Mycologia 93: 38-53.

Ларена, И., О. Салазар, В. Гонсалес, М. Хулиан и В. Рубио. 1999. Разработка праймера для внутреннего транскрибируемого спейсера рибосомальной ДНК с повышенная специфичность для аскомицетов. Журнал биотехнологии 75: 187-194.

Lohtander, K., L. Myllys, R. Сундин, М. Келлэрсьё и А. Телер. 1998. Концепция видовой пары в лишайник Dendrographa leucophaea (Arthoniales): анализ на основе ITS-последовательностей. Бриолог 101: 404-411.

Vilgalys, R. & M. Hester. 1990. Быстрая генетическая идентификация и картирование ферментативно усиленных рибосомная ДНК из нескольких Cryptococcus разновидность. Бактериологический журнал 172: 4238-4246.

Уайт, Т.Дж., Т. Брунс, С. Ли и Дж. Тейлор. 1990 г. Амплификация и прямое секвенирование генов рибосомных РНК грибов для филогенетики. Стр. 315-322 в протоколах ПЦР : Руководство по методам и приложениям (Innis, N., Д. Гельфанд, Дж. Снинский и Т. Уайт, ред.), Academic Press.

Большая ядерная субъединица грибов:


Грунтовка Ф / Р Позиция Последовательность Каталожный номер
LR0R (Rehner) F 24-42 GTACCCGCTGAACTTAAGC Ренер и Сэмюэлс (1994)
LR0R F 26-42 ACCCGCTGAACTTAAGC Веб-сайт Vilgalys? или Cubeta et al.(1991)?
LR1 R 57-73 GGTTGGTTTCTTTTCCT Вилгалис и Хестер (1990)
AL2R F 91-112 GCGAGTGAAGCGGCAACAGCTC Mangold et al. (2008)
ITS4A-5 ' F 96-116 TGAAGCGGCAACAGCTCAAAT Nelsen et al. (2011) / Д.Л. Тейлор в Kroken & Taylor (2001)
ню-LSU-155-5 ' F 136-155 GGGTCCGAGTTGTAATTTGT Döring et al.(2000)
ню-LSU-136-3 ' R 136-154 CAAATTACAACTCGGACCC Döring et al. (2000)
nu-LSU-287-5'-mpn F 270-287 CGAGTTGTTTGGGAATGC Nelsen et al. (2011)
ню-LSU-362-5 ' F 344-362 GCGCACAAGTAGAGTGATC Döring et al. (2000)
ню-LSU-355-3 ' R 355-376 GCTTTTCATCTTTCGATCACTC Döring et al.(2000)
nu-LSU-401-3 ' R 401-419 CCTTTCAACAATTTCACGT Döring et al. (2000)
LR3 (VilWeb) R 635-651 CCGTGTTTCAAGACGGG Vilgalys Веб-сайт
LR3 R 638-654 GGTCCGTGTTTCAAGAC Вилгалис и Хестер (1990)
LR3R F 638-654 GTCTTGAAACACGGACC Веб-сайт Vilgalys?
LR4 R 838-854 ACCAGAGTTTCCTCTGG Веб-сайт Vilgalys?
nu-LSU-871-5 ' F 854-871 TGGAGGCTCGCAGCGGTT Döring et al. (2000)
nu-LSU-896-5 ' F 878-896 TGCAAATCGATCGTCAAAT Döring et al. (2000)
LR5 R 949-965 ATCCTGAGGGAAACTTC Вилгалис и Хестер (1990)
LR6 R 1125-1141 CGCCAGTTCTGCTTACC Вилгалис и Хестер (1990)
LR7 R 1432-1448 TACTACCACCAAGATCT Вилгалис и Хестер (1990)
LR7-R F 1432-1448 AGATCTTGGTGGTAGTA Вилгалис и Хестер (1990)
LR12 R 3106-3122 GACTTAGAGGCGTTCAG Вилгалис и Хестер (1990)

Кубета, М.А., Э. Эчанди, Т. Абернети и Р. Вилгалис. 1991. Характеристика групп анастомозов видов двуядерных Rhizoctonia с использованием рестрикционного анализа амплифицированного ген рибосомной РНК. Фитопатология 81: 1395-400.

Деринг, Х., П. Клерк, М. Грубе и М. Ведин. 2000 г. ПЦР-праймеры для микобионтов для амплификации ядерных ITS и LSU рДНК лихенизированных аскомицетов. Лихенолог 32: 200-204.

Kroken, S. & J.W. Тейлор. 2001 г.Генеалогическая генеалогия подход к распознаванию филогенетических границ видов у лишайникового гриба Letharia . Mycologia 93: 38-53.

Мангольд, А., М.П. Мартин, Р. Люкинг и Х. Lumbsch. 2008. Молекулярная филогения предполагает синонимию Thelotremataceae в пределах Graphidaceae (Ascomycota: Ostropales). Таксон 57: 476-486.

Nelsen, M.P., Lücking, R., Mbatchou, J.S., Andrew, C.J., Шпильманн, А.А. И H.T. Lumbsch. 2011. Новое понимание взаимоотношений лишайниковые дотидеомицеты. Грибок Разнообразие 51: 155-162.

Rehner, S.A. & G.J. Самуэльс. 1994. Таксономия и филогения Gliocladium проанализирована из последовательностей рибосомной ДНК большой субъединицы ядра. Микологические исследования 98: 625-634.

Vilgalys, R. & M. Hester. 1990. Быстрая генетика. идентификация и картирование ферментативно амплифицированной рибосомальной ДНК из несколько видов Cryptococcus . Бактериологический журнал 172: 4238-4246.

Vilgalys Веб-сайт: http: // sites.biology.duke.edu/fungi/mycolab/primers.htm

Большая субъединица водорослевой рибулозо-1,5-бисфосфаткарбоксилазы (rbcL):

Грунтовка Ф / Р Позиция Последовательность Каталожный номер
rbcL1 F 1-20 ATGGTTCCACAAACAGAAAC Nozaki et al.(1995)
Лh2 F 1-26 ATGTCACCACAAACAGAAACTAAAGC Манхарт (1994)
rbcL B F 1-27 ATGTCACCACAAACAGAAACTAAAGCA Вулкотт в Зечман (2003)
rbcL 7F F 7-26 CCAMAAACWGAAACWAAAGC Verbruggen et al. (2009)
FT122 F 149–168 CAGAAGAAGCAGGAGCAGCA Rindi et al. (2009)
FT147 F 174–193 GGCAGAATCATCAACAGGAA Rindi et al. (2009)
a-ch-rbcL-203-5’-MPN F 178-203 GAATCWTCWACWGGWACTTGGACWAC Nelsen et al.(2011)
rbcL320 F 320-341 TATTCGAAGAAGGTTCAGTAAC Nozaki et al. (1995)
rbcL395 R 376-395 GCACGTAAAGCTTTGAAACC Nozaki et al. (1995)
rbcL 7 F 391-409 CGTGCTCTTCGTTTAGAAG Зечман (2003)
rbcL 7R R 391-409 CTTCTAAACGAAGAGCACG Зечман (2003)
rbcL 436F F 436-455 AAAACWTTYCAAGGICCICC Verbruggen et al. (2009)
a-ch-rbcL-494-5’-MPN F 475-494 CGTGAYAAAHTDAACAAATA Nelsen et al. (2011)
rbcL 530R р 511-530 TTWGGTTTAATWGTACARCC Verbruggen et al. (2009)
rbcL650 F 650-671 GTTTCCTTTTCGTAGCTGAAGC Nozaki et al.(1995)
a-ch-rbcL-706-3’-MPN R 706-722 AAAGGNCANATNNTAAA Nelsen et al. (2011)
rbcL 712F F 712-731 CATTAYTTAAATGCWACWGC Verbruggen et al. (2009)
rbcL 791R R 769-788 GGNAYACCNAAWTCTTTIGC Verbruggen et al.(2009)
rbcL803 R 782-803 TCGTGCATAATAATAGGTACAC Nozaki et al. (1995)
rbcL 808F F 808-827 TTAACTGGWGGTTKKACIGC Verbruggen et al. (2009)
rbcL830 р 809-830 TTAGCTGTGAAACCACCTGTTA Nozaki et al.(1995)
rbcL 893R R 874-893 TGCATKGCACGRTGIATRTG Verbruggen et al. (2009)
rbcL 904R R 886-904 CAATAACMGCRTGCATAGC Verbruggen et al. (2009)
rbcL 9 F 922-938 GGTATGCACTTCCGTGT Зечман (2003)
rbcL 9R R 922-938 ACACGGAAGTGCATACC Зечман (2003)
a-ch-rbcL-991-3’-MPN R 991-1010 CCTTCTARTTTACCWACAAC Nelsen et al. (2011)
RT994 R 994-1017 TCTATCTCCTTCTAATTTTCCTAC Rindi et al. (2009)
RT1134 R 1141-1161 CATGTGCCAAATGTGAATACC Rindi et al. (2008)
rbcL1181 R 1160-1181 AAGATTTCAACTAAAGCTGGCA Nozaki et al.(1995)
R1220 R 1220–1244 GGTGCATTACCCCATGGGTGTCCTA Rindi et al. (2008)
rbcL 1391R R 1372–1391 TCTTTCCAAACTTCACAAGC Verbruggen et al. (2009)
rbcL Q R 1372–1395 GATCTCCTTCCATACTTCACAAGC Вулкотт в Зечман (2003)
rbcL 1385R R 1385–1406 AATTCAAATTTAATTTCTTTCC Манхарт (1994)
rbcL1421 R 1402-1421 TTGTCAATAGTATCAAATTC Nozaki et al. (1995)

Manhart, J.R. 1994. Филогенетический анализ зеленых растений последовательностей rbcL . Молекулярная филогенетика и эволюция 3: 114-127.

Nelsen, M.P., E. Rivas Plata, C.J. Andrew, R. Lücking & H.T. Lumbsch. 2011. Филогенетическое разнообразие ассоциированных трентепохлиевых водорослей. с лишайниковыми грибами. Журнал Психология 47: 282-290.

Нодзаки, Х., М. Ито, Р. Сано, Х. Учида, М. Ватанабэ, Х.Такахаши и Т. Куроива. 1995. Филогенетические отношения внутри колониальные Volvocales (Chlorophyta), выведенные из данных о последовательности гена rbcL. Психологический журнал 31: 970-979.

Ринди, Ф., доктор медицины Гири и Дж. М. Лопес-Баутиста. 2008. Распространение, морфология и филогения Klebsormidium (Klebsormidiales, Charophyceae) в городских условиях в Европе. Психологический журнал 44: 1529-1540.

Ринди, Ф., Д. У. Лам и Дж. М. Лопес-Баутиста. 2009 г.Филогенетические отношения и описание видов в Trentepohlia и Printzina (Trentepohliales, Chlorophyta). Молекулярный Филогенетика и эволюция 52: 329-339.

Verbruggen, H., M. Ashworth, S.T. LoDuca, C. Vlaeminck, E. Cocquyt, T. Sauvage, F.W. Zechman, D.S. Littler, M.M. Литтлер, Ф. Лелиарт & O. DeClecrk. 2009. Мультилокусная филогения сифонные зеленые водоросли. Молекулярный Филогенетика и эволюция 50: 642-653.

Зехман, Ф.В. 2003. Филогения Dasycladales (Chlorophyta, Ulvophyceae) на основе анализа большой субъединицы рубиско (rbcL) генные последовательности. Психологический журнал 39: 819-827.

Внутренняя транскрибированная спейсер для водорослей (ITS):

Грунтовка Ф / Р Локус Позиция Последовательность Каталожный номер
* AL1500af F 18S 1458–1474 GCGCGCTACACTGATGC Helms et al. (2001)
* AL1500bf F 18S 1470–1488 GATGCATTCAACGAGCCTA Helms et al. (2001)
* KL-ITS1A2 F 18S 1648–1668 CGATTGGGTGTGCTGGTGAAG Lohtander et al. (2003)
* ITS1AKL F 18S 1657–1676 GTGCTGGTGAAGTGTTCGGA Dahlkild et al.(2001)
* AL1729 F 18S 1722-1745 AACCCTCCCACYTAGAGGAGGGAG Helms et al. (2001)
* AL1700f F 18S 1728-1745 CCCACCTAGAGGAAGGAG Helms et al. (2001)
* a-nu-ssu-1752-5 ’ F 18S 1733-1752 ctagaggaaggagaagtcgt Нельсен и Гаргас (2006)
ИТС1 F 18S 1762-1780 TCCGTAGGTGAACCTGCGG White et al. (1990)
* nr-SSU-1780-5 ’Algal F 18С-ИТС1 1775-4 CTGCGGAAGGATCATTGATTC Piercey-Normore & ДеПрист (2001)
* ITS1T F 18С-ИТС1 1779-10 ggaaggatcattgaatctatcgt Крокен и Тейлор (2000)
* ИТС6АКЛ р 28S 7-24 ATCTTGCCTGAGCTCAGG Dahlkild et al.(2001)
ИТС3 F 5,8S 31-50 GCATCGATGAAGAACGCAGC White et al. (1990)
ITS3T F 5,8S 33-53 AACGATGAAGAACGCAGCGAA Крокен и Тейлор (2000)
ИТС2 R 5,8S 31-50 GCTGCGTTCTTCATCGATGC White et al. (1990
ITS2T R 5. 8S 33-53 TTCGCTGCGTTCTTCATCGTT Крокен и Тейлор (2000)
* nr-LSU-0012-3 ’Algal R 28S 19-37 AGTTCAGCGGGTGGTCTTG Пирси-Нормор и ДеПрист (2001)
ИТС4 R 28S 41-60 TCCTCCGCTTATTGATATGC White et al. (1990)
LR1 R 28S 57-73 GGTTGGTTTCTTTTCCT Vilgalys & Hester (1990)
* ITS4T р 28S 84-102 ggttcgctcgccgctacta Крокен и Тейлор (2000)
* CHspeHLR1R R 28S 136-158 CACTAGACTACAATTCGCCAGCC Hoshina et al.(2005)
* HLR3R R 28S 264-282 TCCCAAACAACCCGACTCT Hoshina et al. (2005)

* Праймер усиливает преимущественно водоросли.

Многие из этих праймеров использовались в комбинации друг с другом для амплификации ITS водорослей непосредственно из талломов лишайника.

Позиции SSU относительно Chlamydomonas reinhardtii M32703

5.8S позиции относительно Chlamydomonas reinhardtii U66954

Позиции LSU относительно Pseudochlorella pringhsheimii D17810

Далькильд, Å, М.Källersjö, K. Lohtander & A. Tehler. 2001. Разнообразие фотобионтов Physciaceae (Lecanorales). Бриолог 104: 527-536.

Хелмс, Г., Т. Фридл, Г. Рамбольд и Х. Майрхофер. 2001 г. Идентификация фотобионтов из семейства лишайников Physciaceae с использованием специфичные для водорослей последовательности ITS рДНК. Лихенолог 33: 73-86.

Хосина, Р., Ю., Камако и Н. Имамура. 2005. Генетический свидетельства симбиотических водорослей «американского» и «европейского» типа Paramecium bursaria Ehrenberg. Биология растений 7: 525-532.

Kroken, S. & J.W. Тейлор. 2000. Филогенетические виды, репродуктивный режим и специфичность зеленой водоросли Trebouxia , образующей лишайники с грибами рода Letharia . Бриолог 103: 645-660.

Lohtander, K., I. Oksanen & J. Rikkinen. 2003. Генетический разнообразие фотобионтов зеленых водорослей и цианобактерий в Nephroma (Peltigerales). Лихенолог 35: 325-339.

Нельсен, М.П. и А. Гаргас. 2006. Интроны актина I типа. предлагают потенциал для увеличения филогенетического разрешения Asterochloris (Chlorophyta: Trebouxiophyceae). Лихенолог 38: 435-440.

Piercey-Normore, M.D. & P.T. DePriest. 2001. Водоросль переключение между симбиозами лишайников. Американский Журнал ботаники 88: 1490-1498.

Vilgalys, R. & M. Hester. 1990. Быстрая генетическая идентификация и картирование ферментативно амплифицированной рибосомальной ДНК нескольких видов Cryptococcus . Бактериологический журнал 172: 4238-4246.

Уайт, Т.Дж., Т. Брунс, С. Ли и Дж. Тейлор. 1990. Амплификация и прямое секвенирование генов грибных рибосомных РНК для филогенетики. Стр. 315-322 в протоколах ПЦР: Руководство по методам и приложениям (Innis, N., D. Gelfand, J. Sninsky & T. White, Eds.), Academic Press.

AM5015 Антимикробный эпоксидный грунт

против грибка плесени плесени устойчивый

ИНСТРУКЦИЯ ПО СМЕШИВАНИЮ И НАНЕСЕНИЮ

ХРАНЕНИЕ ПРОДУКТА: Храните продукт в таком месте, чтобы довести материал до нормальной комнатной температуры перед использованием.Температура непрерывного хранения должна составлять от 60 до 90 градусов по Фаренгейту. Беречь от замерзания.

ПОДГОТОВКА ПОВЕРХНОСТИ : Подготовка поверхности будет зависеть от типа всей применяемой системы. Для системы тонкого покрытия в один или два слоя (высыхание 3-10 мил) мы рекомендуем механическую скарификацию или кислотное травление до получения подходящего профиля. Для полной сборки системы с высыханием более 10 мил мы рекомендуем тонкую струйную очистку (дробеструйную очистку). Вся грязь, масло, пыль, посторонние примеси и цементное молоко должны быть удалены, чтобы обеспечить надежное соединение с основанием.Следует провести испытание, чтобы определить, имеет ли бетон соответствующий пароизоляционный слой. Это можно сделать, поместив пластиковый лист размером 4х4 дюйма на основу и заклеив края скотчем. Если по прошествии 24 часов подложка под пластиковым листом все еще остается сухой, значит, на подложке нет признаков возможных проблем с гидростатическим давлением, которые впоследствии могут привести к распаду. Однако этот продукт можно наносить на влажный пол, если на нем нет стоячих луж.

СМЕШИВАНИЕ ПРОДУКТОВ : Этот продукт поставляется расфасованным по весу.Наборы следует смешивать целиком. Если должны использоваться частичные комплекты, обратитесь к началу этих технических данных для определения правильного соотношения веса смеси. После того, как две части объединены, хорошо перемешайте с помощью низкоскоростного смесительного оборудования, такого как быстрый миксер, до тех пор, пока материал не будет тщательно перемешан и не останется полос. Этот продукт представляет собой эмульсию и перед этим следует хорошо перемешать. Неправильное смешивание может привести к выходу продукта из строя. Для достижения наилучших результатов смешивания и правильного смешивания частей A и B рекомендуется дрель-миксер Jiffy Mixer .

ПРИМЕНЕНИЕ ПРОДУКТА : Смешанный материал можно наносить кистью или валиком. Во время нанесения и отверждения поддерживайте температуру в рекомендуемых диапазонах. Наносите материал с относительной влажностью в пределах параметров, указанных в технических характеристиках. Когда истечет срок жизнеспособности, вы обнаружите, что материал становится трудно наносить, и он действительно будет скатываться обратно на валик. Не пытайтесь продолжить нанесение, когда покрытие достигнет этого этапа. При нанесении в разное время и в разных условиях окружающей среды может наблюдаться небольшой разброс блеска.

ПОВТОРНОЕ ПОКРЫТИЕ ИЛИ ТОЧНОЕ ПОКРЫТИЕ: Если вы выбрали повторное или верхнее покрытие этого продукта, вы должны сначала убедиться, что все растворители и вода испарились с покрытия во время процесса отверждения. Информация на лицевой стороне - надежные рекомендации, которым нужно следовать. Однако лучше всего протестировать покрытие перед повторным или верхним покрытием. Это можно сделать, нажав на покрытие большим пальцем, чтобы убедиться, что отпечатков пальцев не осталось.Если отпечатка не создается, можно начинать перекрытие или финишное покрытие. Всегда помните, что при более низких температурах потребуется больше времени для отверждения продукта, прежде чем можно будет начать повторное или верхнее покрытие. Перед повторным или верхним покрытием проверьте покрытие, чтобы убедиться, что на нем не появились румяна от эпоксидной смолы (беловатая, жирная пленка или обесцвечивание). Если присутствует румянец, его необходимо удалить перед нанесением верхнего или следующего слоя. Для удаления любых румян можно использовать моющее средство стандартного типа. Многие эпоксидные покрытия и покрытия, а также уретаны подходят для использования в качестве верхнего покрытия для этого продукта, а также для нанесения нескольких слоев этого продукта.

CLEANUP : Используйте растворитель PM

ЧИСТКА ПОЛА: Внимание! Некоторые чистящие средства могут повлиять на цвет уложенного пола. Испытайте каждый очиститель на небольшом участке, используя вашу технику очистки. Если никаких побочных эффектов не наблюдается, вы можете продолжить очистку с помощью протестированного продукта и процесса.

ОГРАНИЧЕНИЯ : Ограничьте использование пола легким движением и не агрессивными химикатами до полного отверждения покрытия (см. Технические данные в разделе «Полное отверждение»).Лучше всего, чтобы пол оставался сухим в течение полного цикла отверждения. В зависимости от фактического применения всей системы поверхность может быть скользкой, особенно в мокром виде или в загрязненном состоянии; держите поверхность чистой и сухой.

ОГРАНИЧЕНИЯ:
  • На цвет или блеск может повлиять влажность, низкие температуры, химическое воздействие или освещение парами натрия.
  • Продукт желтеет в присутствии УФ-излучения
  • Для получения наилучших результатов используйте валик с ворсом 1/4 дюйма или 3/8 дюйма.
  • Плита на грунте требует гидроизоляции
  • Температура поверхности должна быть на 5 ° F выше точки росы.
  • Весь новый бетон должен выдерживаться не менее 30 дней
  • Неправильное смешивание или слишком толстый слой нанесения могут привести к выходу продукта из строя
  • Физические свойства, перечисленные в этом техническом паспорте, являются типичными значениями, а не спецификациями.
  • См. Вкладку с инструкциями по применению.
  • Ограничения нашей ответственности и гарантии см. На вкладке «Приложение»

УВЕДОМЛЕНИЕ ДЛЯ ПОКУПАТЕЛЯ: ОТКАЗ ОТ ГАРАНТИЙ И ОГРАНИЧЕНИЙ НАШЕЙ ОТВЕТСТВЕННОСТИ Мы гарантируем, что наша продукция произведена в соответствии со строгими требованиями к обеспечению качества и что предоставленная нами информация является точной, насколько нам известно.Такая информация о наших продуктах не является заявлением или гарантией. Он предоставляется при условии, что вы проведете свои собственные испытания, чтобы определить пригодность нашего продукта для вашей конкретной цели. Ответственность за любое использование или приложение, отличное от рекомендованного в данном документе, несет пользователь. Перечисленные физические свойства являются типичными и не должны рассматриваться как спецификации. НИКАКИХ ГАРАНТИЙ НЕ ПРЕДОСТАВЛЯЕТСЯ, ЯВНЫХ ИЛИ ПОДРАЗУМЕВАЕМЫХ В ОТНОШЕНИИ ДРУГОЙ ИНФОРМАЦИИ, ДАННЫХ, НА КОТОРЫХ ЕГО ОСНОВАНА, ИЛИ РЕЗУЛЬТАТОВ, КОТОРЫЕ ВЫ ПОЛУЧИТЕ В РЕЗУЛЬТАТЕ ЕГО ИСПОЛЬЗОВАНИЯ.ГАРАНТИЯ НЕ ПРЕДОСТАВЛЯЕТСЯ, ВЫРАЖАЕТСЯ ИЛИ ПОДРАЗУМЕВАЕТСЯ, ЧТО НАША ПРОДУКЦИЯ ДОЛЖНА БЫТЬ ТОВАРНОЙ ИЛИ НАША ПРОДУКЦИЯ ПОДХОДИТ ДЛЯ ЛЮБЫХ КОНКРЕТНЫХ ЦЕЛЕЙ. НЕ ДАЕТСЯ ГАРАНТИИ, ЧТО ИСПОЛЬЗОВАНИЕ ТАКОЙ ИНФОРМАЦИИ ИЛИ НАШЕГО ПРОДУКТА НЕ ЯВЛЯЕТСЯ НАРУШЕНИЕМ НИКАКИХ ПАТЕНТОВ. Мы не несем ответственности за случайные или косвенные убытки, прямые или косвенные. Наша ответственность ограничивается чистой продажной ценой нашего продукта или заменой нашего продукта по нашему выбору. Принятие доставки нашего продукта означает, что вы приняли условия этой гарантии, независимо от того, содержат ли заказы на покупку или другие документы условия, которые отличаются от данной гарантии.Ни один представитель не уполномочен делать какие-либо заявления, давать гарантии или брать на себя какие-либо другие обязательства от нашего имени при продаже наших продуктов. Наша продукция

Праймер для микроскопии молекулярных выражений

: специализированные методы микроскопии - галерея изображений с дифференциальным интерференционным контрастом


Галерея изображений с дифференциальным интерференционным контрастом
Грибок (
Sordaria fimicola ) Плодовые тела

Sordaria fimicola - гриб аскомицет, который обычно растет на разлагающемся органическом материале. Его также часто можно найти во вводных лабораторных условиях, где им манипулируют и исследуют в образовательных целях.

Аскомицеты известны как мешочные грибы из-за характерной формы их асков , каждый из которых содержит от четырех до восьми аскоспор на половой стадии. Конкретные атрибуты асков и метод высвобождения аскоспор - вот что в первую очередь определяет, к какой подгруппе видов аскомицетов относятся.Однако между грибами существуют и другие различия, которые могут следовать очень разными путями существования. Некоторые аскомицеты являются патогенами, вызывающими заболевания растений или животных, в то время как другие съедобны или безвредно питаются мертвым органическим веществом. Возможно, наиболее важным для человека аскомицетом является Saccharomyces cerevisiae , распространенные дрожжи, которые используются во всем мире для закваски хлеба и ферментации зерна, из которого производится пиво.

Популярность использования S. fimicola в качестве учебного пособия во многом объясняется простотой работы. Гриб хорошо растет в культуре и может производить зрелые перитеций или плодовых тел примерно за неделю. Затем студенты могут легко наблюдать мейотическое деление диплоидных перитеций, в результате чего образуются упорядоченные линейные тетрады, заключенные в мешочек аска. Впоследствии эти тетрады превращаются в октады путем митоза гаплоидных аскоспор, что дает студентам возможность узнать о другом важном биологическом процессе.

НАЗАД В ГАЛЕРЕЮ ИЗОБРАЖЕНИЙ DIC

Вопросы или комментарии? Отправить нам письмо.
© 1998-2019, автор - Майкл В. Дэвидсон и Государственный университет Флориды. Все права защищены. Никакие изображения, графика, сценарии или апплеты не могут быть воспроизведены или использованы каким-либо образом без разрешения правообладателей. Использование этого веб-сайта означает, что вы соглашаетесь со всеми Правовыми положениями и условиями, изложенными владельцами.
Этот веб-сайт обслуживается командой

по графике и веб-программированию
в сотрудничестве с оптической микроскопией в Национальной лаборатории сильного магнитного поля
.
Последнее изменение: пятница, 13 ноября 2015 г., 13:19
Количество обращений с 22 апреля 2003 г .: 40308
Для получения дополнительной информации о производителях микроскопов,

используйте кнопки ниже для перехода на их веб-сайты:

Грунтовка для внутренних и наружных работ KILZ® MOLD & MILDEW

KILZ® MOLD & MILDEW Интерьер | Внешняя грунтовка оценена 4.9 из 5 автор: 152.

Оценка 5 из 5 к Отремонтировать маму от Прощай, форма для ванной Легко наносится и устраняет стойкие пятна плесени, которые преследовали потолок моей ванной комнаты. 6 месяцев и никаких признаков его возврата.

Дата публикации: 2021-02-23

Оценка 5 из 5 к Rikki47 из Работает идеально и помогает защитить Это так хорошо сработало. У нас были проблемы с плесенью, мы вынули и отремонтировали участки, где она была, и нуждались в дополнительной защите от плесени и грибка. С тех пор у нас не было никаких проблем.

Дата публикации: 2021-02-22

Оценка 5 из 5 к Sis07 из Грунтовка для плесени и грибка Я купил это, потому что это единственный бренд, который я покупаю. Это сработало отлично!

Дата публикации: 21.02.2021

Оценка 5 из 5 к Ли Энн из Отличная грунтовочная краска! Покрасили синюю плитку в нашей ванной комнате с помощью грунтовки для кухни или ванны от плесени и плесени, и это сработало так здорово - отличное долговечное качество покрытия! Walso

Дата публикации: 2021-02-20

Подготовка поверхности

Следующие шаги рекомендуются для повышения производительности продукта.

  • Все поверхности должны быть чистыми, сухими, очищенными от пыли, мела, масла, жира, воска, полироли, отслаивающейся или отслаивающейся краски, ржавчины и других посторонних веществ.
  • При необходимости стирки используйте немыльное моющее средство или заменитель TSP, хорошо промойте и дайте высохнуть.
  • Отслаивающаяся или проверенная краска: Соскребите отслоившуюся краску и отшлифуйте до гладкой поверхности.
  • Глянцевые поверхности: Для максимальной адгезии тщательно отшлифуйте поверхность перед нанесением грунтовки. *
  • Покрытые плесенью или плесенью поверхности: Этот продукт разработан для предотвращения образования плесени и / или грибка и загрязнения грунтовочной пленки перед нанесением верхнего покрытия.Хотя он предназначен для нанесения непосредственно на поверхности, подверженные плесени и плесени, любую существующую плесень и / или грибок на поверхности следует удалить перед грунтованием и окраской. Это обеспечит наилучшие результаты. Промойте участок средством для удаления плесени, промойте водой и дайте высохнуть перед нанесением грунтовки.
  • Кладка, кирпич и штукатурка: Грунтовка KILZ MOLD & MILDEW может использоваться на чистых, сухих, состаренных поверхностях кладки. Перед нанесением грунтовки KILZ MOLD & MILDEW Primer необходимо дать новой кладке высохнуть не менее чем за 30 дней.
  • Восстановление огня: не рекомендуется. Рекомендации по грунтовке: KILZ® ORIGINAL, KILZ® ORIGINAL INTERIOR / EXTERIOR и KILZ® RESTORATION.

* ВНИМАНИЕ! Если поскрести, отшлифовать или удалить старую краску, возможно выделение свинцовой пыли. Свинец Ядовит. Свяжитесь с Национальным центром информации по лидерам по телефону 1-800-424-LEAD или войдите на сайт www.epa.gov/lead.

Заявление

  • Рекомендуются средства защиты глаз. Для распыления можно добавить небольшое количество воды (не более 1/2 пинты на галлон).Не разбавляйте для пятновыводящих средств.
  • Применяется только в том случае, если температура поверхности, воздуха и продукта составляет 10–32 ° C (50–90 ° F). Тщательно перемешивайте перед использованием и время от времени во время использования. Нанести кистью, валиком или распылителем.
  • Кисть - высококачественный нейлон / полиэстер.
  • Валик - Высококачественный ворс 3/8-1 / 2 дюйма на гладких поверхностях или ворс 1 / 2-3 / 4 дюйма на полушероховатых или пористых поверхностях.
  • Безвоздушное распыление - наконечник 0,017-0,021 дюйма / фильтр 60 меш.
  • Загрунтуйте всю поверхность, чтобы обеспечить однородный внешний вид верхнего покрытия.
  • Блокирование пятен: после нанесения грунтовки проверьте, не просачивается ли пятно, нанеся верхнее покрытие на небольшой участок. Если пятно просачивается через финишный слой, нанесите второй слой грунтовки и повторите тест перед нанесением финишного покрытия всей области. Если кровотечение продолжается, перед нанесением верхнего покрытия необходимо более длительное время высыхания.
  • Колеровка: KILZ MOLD & MILDEW Primer можно тонировать, используя до 2 унций универсального красителя на галлон. Рекомендуется подкрашивать до более светлого оттенка, чем финишное покрытие.
  • Покрытие: 300-400 кв.футов (27,87-37 м 2 ) на галлон в зависимости от метода нанесения и пористости поверхности.

Время высыхания при 77 ° F (25 ° C), относительной влажности 50%

Очистка и утилизация

  • Очистите оборудование и брызги краски теплой мыльной водой.
  • Не выбрасывайте этот продукт в канализацию. Пожалуйста, рассмотрите возможность пожертвовать неиспользованный продукт. Для получения информации о переработке или утилизации обратитесь в местную службу вывоза бытового мусора.
  • В случае разлива соберите материал и удалите инертным абсорбентом.Утилизируйте загрязненный абсорбент, контейнер и неиспользованный продукт в соответствии со всеми действующими федеральными, государственными и местными правилами. Для получения информации о переработке или утилизации обратитесь в местную службу вывоза бытового мусора.

ПОЖИЗНЕННАЯ ОГРАНИЧЕННАЯ ГАРАНТИЯ

Masterchem Industries LLC гарантирует вам, первоначальному покупателю-потребителю, работоспособность этого продукта в соответствии с описанием на этой этикетке, пока вы проживаете в своем доме. Если в результате проверки его представителем будет обнаружен дефект, Masterchem Industries LLC по своему усмотрению и при предъявлении подтверждения покупки (оригинала квитанции) либо предоставит эквивалентное количество нового продукта, либо вернет первоначальную покупную цену. этого продукта вам.Эта гарантия не подлежит передаче. Эта гарантия не включает (1) труд и затраты на рабочую силу для установки или удаления любого продукта и (2) любые побочные или косвенные убытки, вызванные нарушением явной или подразумеваемой гарантии, халатностью, строгой ответственностью или любой другой правовой теорией. . В некоторых штатах не допускается исключение или ограничение случайных или косвенных убытков, поэтому вышеуказанное ограничение или исключение может не относиться к вам. В той степени, в которой это разрешено применимым законодательством, любые подразумеваемые гарантии, включая подразумеваемые гарантии товарной пригодности и пригодности для определенной цели, ограничиваются сроком действия данной прямой гарантии. В некоторых штатах не допускается ограничение срока действия подразумеваемой гарантии, поэтому вышеуказанное ограничение может не относиться к вам. Эта гарантия дает вам определенные юридические права, и вы также можете иметь другие права, которые варьируются от штата к штату. Примечание для жителей штата Нью-Джерси: Положения данной гарантии, включая ее ограничения, применяются в максимальной степени, разрешенной законами штата Нью-Джерси. Для гарантийного обслуживания звоните: 1-866-774-6371 или по электронной почте: techservice @ masterchem.com. Masterchem Industries LLC оставляет за собой право проверять любое применение продукта перед обработкой вашей претензии по данной гарантии.

Внимание!

Этот продукт содержит химические вещества, которые, как известно в штате Калифорния, вызывают рак, врожденные дефекты или другие нарушения репродуктивной системы.

ВНИМАНИЕ! Если поскрести, отшлифовать или удалить старую краску, может образоваться свинцовая пыль. Свинец Ядовит. ВОЗДЕЙСТВИЕ СВИНЦОВОЙ ПЫЛИ МОЖЕТ ПРИВЕСТИ К СЕРЬЕЗНЫМ ЗАБОЛЕВАНИЯМ, ТАКИМ КАК ПОВРЕЖДЕНИЕ МОЗГА, ОСОБЕННО У ДЕТЕЙ.БЕРЕМЕННЫМ ЖЕНЩИНАМ ТАКЖЕ СЛЕДУЕТ ИЗБЕГАТЬ ВОЗДЕЙСТВИЯ. Надевайте респиратор, одобренный NIOSH, чтобы контролировать воздействие свинца. Тщательно очистите пылесосом HEPA и влажной шваброй. Прежде чем начать, узнайте, как защитить себя и свою семью, связавшись с Национальным ведущим информационным центром по телефону 1-800-424-LEAD или войдите на сайт www.epa.gov/lead.

ИСПОЛЬЗУЙТЕ ТОЛЬКО С ДОПОЛНИТЕЛЬНОЙ ВЕНТИЛЯЦИЕЙ

ВНИМАНИЕ! РАЗДРАЖАЕТ! ВРЕДНО ИЛИ СМЕРТЕЛЬНО ПРИ ПРОГЛАТЫВАНИИ. Избегать контакта с глазами. Может вызвать раздражение глаз, носа и горла.Избегайте вдыхания пыли, паров или аэрозольного тумана. Откройте окна и двери или используйте другие средства для обеспечения доступа свежего воздуха во время нанесения и высыхания. Если вы испытываете слезотечение, головную боль или головокружение, или если мониторинг воздуха показывает, что уровни пара / тумана превышают применимые пределы, наденьте соответствующий респиратор надлежащим образом (NIOSH / MSHA TC 23C или аналогичный) во время и после нанесения. Следуйте инструкциям производителя респиратора по использованию респиратора. Закройте контейнер после каждого использования. Тщательно вымыть после работы, а также перед курением и едой.ВНИМАНИЕ! Этот продукт содержит химические вещества, которые, как известно в штате Калифорния, вызывают рак, врожденные дефекты или другие нарушения репродуктивной системы.

Первая помощь

При проглатывании не вызывать рвоту. Немедленно обратитесь за медицинской помощью. Если вы испытываете затрудненное дыхание, выйдите из помещения, чтобы подышать свежим воздухом. Если трудности не исчезнут, немедленно обратитесь за медицинской помощью. В случае попадания в глаза немедленно промойте глаза большим количеством воды в течение не менее 15 минут и обратитесь за медицинской помощью.

БЕЗ ЗАМЕРЗАНИЯ. Если заморожен, дайте ему разморозиться при комнатной температуре.

ХРАНИТЬ В НЕДОСТУПНОМ ДЛЯ ДЕТЕЙ!

UNITE - Примечания и новости

Февраль 2020 г . : Выпущена новая версия UNITE SH (v8.2). Справочные наборы данных доступны на странице ресурсов UNITE.

В декабре 2019 года NEFOM получил 182 000 шведских крон от SNS и ForBioeconomy для новых мероприятий в течение 2020 года по теме «Возвращение к истокам».

Октябрь 2018: Новая статья Нильссона и др .: База данных UNITE для молекулярной идентификации грибов: работа с темными таксонами и параллельные таксономические классификации.

В июле 2018 года в основную таксономию GBIF были добавлены нелиннеевские идентификаторы на основе последовательностей (коды UNITE SH) (подробнее см. На gbif.org).

Июнь 2017 г .: Новые справочные наборы данных UNITE (версия SH 7.2, незначительное обновление) доступны на странице ресурсов UNITE.

4 мая 2017 г .: Призыв к гражданским ученым «Отправьте образцы на секвенирование!»

5 февраля 2016 г . : Мы создали учетную запись сообщества UNITE в Twitter для получения новостей и обновлений. Следуйте за нами, и вы всегда будете в курсе новостей UNITE.

13 октября 2015 г .: Открыта новая домашняя страница UNITE.

2 марта 2015: Единая система для видов грибов на основе ДНК (вер.7.0) выпущен.

14 октября 2013 г .: обновлена ​​домашняя страница UNITE: выпущена унифицированная система для видов грибов на основе ДНК (версия 5.0).

март-август 2013 г .: Новые документы, относящиеся к усилиям UNITE: Kõljalg et al. 2013, Lindahl et al. 2013 г., Бентссон-Пальме и др. 2013, Линднер и др. 2013 г., Бейтс и др. 2013 г., и Hyde et al. 2013.

Сентябрь 2012 г .: Последовательности ДНК тоже требуют качественного времени - опубликовано руководство по контролю качества
Nilsson RH, Tedersoo L, Abarenkov K, Ryberg M, Kristiansson E, Hartmann M, Schoch CL, Nylander JAA, Bergsten J, Porter TM, Jumpponen A, Vaishampayan P, Ovaskainen O, Hallenberg N, Bengtsson-Palme J, Eriksson KM, Larsson KH, Larsson E, Kõljalg U (2012) Пять простых рекомендаций по установлению базовой аутентичности и надежности вновь созданных ITS-последовательностей грибов. MycoKeys 4: 37-62. DOI: 10.3897 / mycokeys.4.3606

Лето 2010 г .: Доля обратных комплементарных последовательностей ITS в INSD быстро растет, что может иметь пагубные последствия для неосведомленного пользователя. Мы разработали программное решение, которое мы планируем запустить в UNITE к концу августа 2010 года.

По состоянию на апрель 2010 г., PlutoF дает пользователю возможность извлекать (определять местонахождение) ITS1 и ITS2 из (не) грибковых последовательностей ITS.Версия для малой субъединицы рибосом (SSU / 16S / 18S) находится в разработке.

По состоянию на март 2010 года PlutoF теперь предлагает общую поддержку для химерных тестов полноразмерных грибковых ITS-последовательностей.

В феврале 2010 года в UNITE был добавлен новый конвейер 454 для анализа ITS-последовательностей грибов.

По состоянию на март 2009 г. , поддержка последовательностей UNITE ITS из образцов окружающей среды (например, почвы, эктомикоризных корней, орхидей и т. Д.)) включен. Вы можете включить последовательности с хорошими метаданными (такими как хозяин, местонахождение, среда обитания и параметры почвы) в свои прогоны BLAST и galaxieBLAST, щелкнув «Окружающая среда». поле рядом с кнопкой "Отправить". Текущее количество ITS-последовательностей грибов из проб окружающей среды в UNITE: 7123

По состоянию на май 2006 г. включена поддержка ITS-последовательностей INSD (GenBank, EMBL, DDBJ). Это означает, что за один прогон BLAST вы можете сравнить свои последовательности с последовательностями в UNITE и INSD.(Это также относится к galaxieBLAST.) Все, что вам нужно сделать, это щелкнуть поле «INSD» рядом с кнопкой «Отправить»; конечно, отказ от нажатия этой кнопки равносилен работе только с данными UNITE. Мы используем технологию emerencia (PDF) для поддержки INSD; все должным образом аннотированные ITS-последовательности грибов INSD следует индексировать и регулярно обновлять (два раза в неделю).

По состоянию на ноябрь 2005 г., galaxieBLAST и galaxieHMM поддерживают последовательности, которые случайно были вставлены в обратном порядке комплементарности (? Revcomp?).Они делают это путем сопоставления с образцом первых 30 п.н. области 5.8S - если последовательность не содержит этот образец, образец будет искать в revcomp последовательности. Если revcomp последовательности имеет этот шаблон, анализ продолжится с revcomp последовательности. Если нет, анализ будет продолжен в исходной последовательности (независимо от того, что в ней нет шаблона). Таким образом, частичные последовательности, лишенные, скажем, ITS1 и 5.8S, также должны быть допустимы. Мы не ожидаем каких-либо серьезных осложнений при использовании этого подхода, но, пожалуйста, сообщите нам о любых проблемах, с которыми вы столкнетесь.Однако, как объяснялось в другом месте, инструменты galaxie адаптированы для работы с полноразмерными (в отличие от частичных) последовательностей ITS, и вам действительно следует использовать обычную функцию BLAST UNITE, если у вас есть только часть доступной области ITS.

Вам может понравится

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *